breseq  version 0.39.0  
mutation predictions | marginal predictions | summary statistics | genome diff | command line log

Predicted mutations
evidence position mutation annotation gene description
JC JC 16,974 IS150 (–) +3 bp noncoding (23‑25/59 nt) sokC → small regulatory RNA antitoxin SokC
RA 23,501 C→T L371L (CTG→TTG)  ileS → isoleucine‑‑tRNA ligase
RA 31,683 C→T N289N (AAC→AAT carB → carbamoyl‑phosphate synthetase large subunit
RA 42,108 G→A intergenic (‑177/‑295) caiT ← / → fixA L‑carnitine:gamma‑butyrobetaine antiporter/putative electron transfer flavoprotein FixA
RA 59,968 C→T V127I (GTC→ATC)  rluA ← 23S rRNA pseudouridine(746) and tRNA pseudouridine(32) synthase
RA 88,571 G→A V182M (GTG→ATG)  cra → DNA‑binding transcriptional dual regulator Cra
RA 246,747 G→T S12S (TCG→TCT yafL → NlpC/P60 family protein YafL
MC JC 257,908 Δ776 bp insB9[crl] insB9, insA9, [crl]
RA 284,535 T→G A445A (GCT→GCG yagF → D‑xylonate dehydratase
RA 313,543 G→A intergenic (‑301/‑1748) ykgR ← / → insE1 putative membrane protein YkgR/IS3 element protein InsE
RA 367,573 G→A intergenic (‑63/+14) lacI ← / ← mhpR DNA‑binding transcriptional repressor LacI/DNA‑binding transcriptional activator MhpR
JC JC 458,790 IS186 (–) +6 bp :: Δ1 bp intergenic (+90/‑93) clpX → / → lon ATP‑dependent Clp protease ATP‑binding subunit ClpX/Lon protease
RA 466,148 G→A P389S (CCA→TCA)  ybaE ← uncharacterized protein YbaE
RA 469,271 G→A G134E (GGG→GAG)  mdlA → ABC transporter family protein MdlA
RA 480,295 2 bp→AA coding (13‑14/219 nt) hha ← hemolysin expression‑modulating protein Hha
RA 502,232 G→A T336I (ACC→ATC)  ybaL ← putative transporter YbaL
RA 566,173 C→G intergenic (‑195/‑511) intD ← / → renD putative integrase/protein RenD
RA 566,205 T→C intergenic (‑227/‑479) intD ← / → renD putative integrase/protein RenD
RA 566,245 G→A intergenic (‑267/‑439) intD ← / → renD putative integrase/protein RenD
RA 566,277 C→T intergenic (‑299/‑407) intD ← / → renD putative integrase/protein RenD
RA 566,323 C→T intergenic (‑345/‑361) intD ← / → renD putative integrase/protein RenD
RA 566,326 T→C intergenic (‑348/‑358) intD ← / → renD putative integrase/protein RenD
RA 566,332 T→G intergenic (‑354/‑352) intD ← / → renD putative integrase/protein RenD
RA 566,356 T→C intergenic (‑378/‑328) intD ← / → renD putative integrase/protein RenD
RA 566,463 T→C intergenic (‑485/‑221) intD ← / → renD putative integrase/protein RenD
RA 566,468 C→T intergenic (‑490/‑216) intD ← / → renD putative integrase/protein RenD
RA 566,492 2 bp→TA intergenic (‑514/‑191) intD ← / → renD putative integrase/protein RenD
RA 566,498 C→T intergenic (‑520/‑186) intD ← / → renD putative integrase/protein RenD
RA 566,510 G→C intergenic (‑532/‑174) intD ← / → renD putative integrase/protein RenD
RA 566,513 C→T intergenic (‑535/‑171) intD ← / → renD putative integrase/protein RenD
RA 566,519 T→C intergenic (‑541/‑165) intD ← / → renD putative integrase/protein RenD
RA 566,522 C→A intergenic (‑544/‑162) intD ← / → renD putative integrase/protein RenD
RA 566,528 A→G intergenic (‑550/‑156) intD ← / → renD putative integrase/protein RenD
RA 566,530 +T intergenic (‑552/‑154) intD ← / → renD putative integrase/protein RenD
RA 566,532 A→T intergenic (‑554/‑152) intD ← / → renD putative integrase/protein RenD
RA 566,535 2 bp→A intergenic (‑557/‑148) intD ← / → renD putative integrase/protein RenD
RA 566,543 A→T intergenic (‑565/‑141) intD ← / → renD putative integrase/protein RenD
RA 566,547 C→A intergenic (‑569/‑137) intD ← / → renD putative integrase/protein RenD
RA 566,565 A→G intergenic (‑587/‑119) intD ← / → renD putative integrase/protein RenD
RA 566,570 A→C intergenic (‑592/‑114) intD ← / → renD putative integrase/protein RenD
RA 566,597 T→C intergenic (‑619/‑87) intD ← / → renD putative integrase/protein RenD
RA 566,651 T→C intergenic (‑673/‑33) intD ← / → renD putative integrase/protein RenD
RA 566,728 G→T pseudogene (45/93 nt) renD → protein RenD
RA 566,740 A→G pseudogene (57/93 nt) renD → protein RenD
RA 566,742 A→C pseudogene (59/93 nt) renD → protein RenD
RA 566,756 G→C pseudogene (73/93 nt) renD → protein RenD
RA 566,770 C→A pseudogene (87/93 nt) renD → protein RenD
RA 568,052 T→C pseudogene (18/213 nt) renD → protein RenD
RA 568,067 G→A pseudogene (33/213 nt) renD → protein RenD
RA 568,076 2 bp→TC pseudogene (42‑43/213 nt) renD → protein RenD
RA 568,079 C→T pseudogene (45/213 nt) renD → protein RenD
RA 568,085 2 bp→TA pseudogene (51‑52/213 nt) renD → protein RenD
RA 568,088 T→C pseudogene (54/213 nt) renD → protein RenD
RA 568,091 T→A pseudogene (57/213 nt) renD → protein RenD
RA 662,269 C→T D4N (GAT→AAT)  lipB ← lipoyl(octanoyl) transferase
RA 696,470 C→T noncoding (35/75 nt) glnX ← tRNA‑Gln
RA 784,677 G→A A49A (GCC→GCT zitB ← Zn(2(+))/Cd(2(+))/Ni(2(+))/Cu(2(+)) exporter
RA 968,837 G→A D158N (GAT→AAT)  lpxK → tetraacyldisaccharide 4'‑kinase
RA 1,040,126 G→T L277L (CTG→CTT appB → cytochrome bd‑II subunit 2
RA 1,061,935 G→A S46N (AGC→AAC)  torD → trimethylamine‑N‑oxide reductase‑specific chaperone
RA 1,069,743 C→T A33T (GCA→ACA)  rutG ← pyrimidine:H(+) symporter
RA 1,098,620 T→A V245V (GTT→GTA ghrA → glyoxylate/hydroxypyruvate reductase A
RA 1,111,727 2 bp→TT coding (865‑866/2544 nt) opgH → osmoregulated periplasmic glucans biosynthesis protein H
RA 1,156,913 G→A G46D (GGT→GAT)  ycfH → putative metal‑dependent hydrolase YcfH
RA 1,169,836 A→G L180P (CTG→CCG)  ldtC ← L,D‑transpeptidase LdtC
RA 1,189,980 A→G T156T (ACT→ACC phoP ← DNA‑binding transcriptional dual regulator PhoP
RA 1,196,220 C→T H366H (CAC→CAT icd → isocitrate dehydrogenase
RA 1,196,232 C→T T370T (ACC→ACT icd → isocitrate dehydrogenase
RA 1,196,245 T→C L375M (TTA→CTG)  icd → isocitrate dehydrogenase
RA 1,196,247 A→G L375M (TTA→CTG icd → isocitrate dehydrogenase
RA 1,196,277 C→T N385N (AAC→AAT icd → isocitrate dehydrogenase
RA 1,196,280 G→C A386A (GCG→GCC icd → isocitrate dehydrogenase
RA 1,196,283 A→G K387K (AAA→AAG icd → isocitrate dehydrogenase
RA 1,196,292 C→T T390T (ACC→ACT icd → isocitrate dehydrogenase
RA 1,196,304 G→A E394E (GAG→GAA icd → isocitrate dehydrogenase
RA 1,196,316 T→A D398E (GAT→GAA icd → isocitrate dehydrogenase
MC JC 1,299,499 Δ1,199 bp insH21 insH21
RA 1,301,992 A→T N271Y (AAT→TAT)  oppA → oligopeptide ABC transporter periplasmic binding protein
RA 1,302,454 Δ1 bp coding (1273/1632 nt) oppA → oligopeptide ABC transporter periplasmic binding protein
RA 1,306,736 T→G S325A (TCC→GCC)  oppF → murein tripeptide ABC transporter/oligopeptide ABC transporter ATP binding subunit OppF
RA 1,310,770 A→G H32H (CAT→CAC yciI ← protein YciI
RA 1,322,759 G→A A63V (GCT→GTT)  trpE ← anthranilate synthase subunit TrpE
RA 1,337,394 A→G S522G (AGC→GGC)  acnA → aconitate hydratase 1
RA 1,357,202 C→T intergenic (‑92/+221) sapA ← / ← ymjA putative periplasmic binding protein SapA/DUF2543 domain‑containing protein YmjA
RA 1,358,859 T→C Y110C (TAT→TGT)  puuP ← putrescine:H(+) symporter PuuP
MC JC 1,367,750 Δ176 bp [pspF] [pspF]
JC JC 1,399,590 IS5 (+) +4 bp intergenic (‑64/+128) fnr ← / ← ogt DNA‑binding transcriptional dual regulator FNR/methylated‑DNA‑‑[protein]‑cysteine S‑methyltransferase
RA 1,401,893 G→A Q455* (CAA→TAA)  abgB ← p‑aminobenzoyl‑glutamate hydrolase subunit B
RA 1,423,338 G→C intergenic (+26/‑62) ydaW → / → rzoR putative uncharacterized protein YdaW/putative prophage outer membrane lipoprotein RzoR
RA 1,423,404 G→T R2L (CGA→CTA)  rzoR → putative prophage outer membrane lipoprotein RzoR
RA 1,428,945 C→T pseudogene (150/189 nt) lomR → Rac prophage; protein LomR_1
RA 1,428,954 T→A pseudogene (159/189 nt) lomR → Rac prophage; protein LomR_1
RA 1,428,963 G→T pseudogene (168/189 nt) lomR → Rac prophage; protein LomR_1
RA 1,428,966 T→G pseudogene (171/189 nt) lomR → Rac prophage; protein LomR_1
RA 1,428,978 G→A pseudogene (183/189 nt) lomR → Rac prophage; protein LomR_1
RA 1,429,021 2 bp→AA intergenic (+37/‑27) lomR → / → stfR Rac prophage; protein LomR_1/putative prophage side tail fiber protein StfR
RA 1,429,024 A→C intergenic (+40/‑25) lomR → / → stfR Rac prophage; protein LomR_1/putative prophage side tail fiber protein StfR
RA 1,429,027 C→T intergenic (+43/‑22) lomR → / → stfR Rac prophage; protein LomR_1/putative prophage side tail fiber protein StfR
RA 1,429,069 T→A G7G (GGT→GGA stfR → putative prophage side tail fiber protein StfR
RA 1,429,072 A→C V8V (GTA→GTC stfR → putative prophage side tail fiber protein StfR
RA 1,429,111 A→C T21T (ACA→ACC stfR → putative prophage side tail fiber protein StfR
RA 1,429,114 C→T I22I (ATC→ATT stfR → putative prophage side tail fiber protein StfR
RA 1,429,126 A→C A26A (GCA→GCC stfR → putative prophage side tail fiber protein StfR
RA 1,429,128 A→G K27R (AAA→AGA)  stfR → putative prophage side tail fiber protein StfR
RA 1,429,160 C→G L38V (CTG→GTG)  stfR → putative prophage side tail fiber protein StfR
RA 1,429,164 C→G A39G (GCC→GGC)  stfR → putative prophage side tail fiber protein StfR
RA 1,429,171 A→G E41E (GAA→GAG stfR → putative prophage side tail fiber protein StfR
RA 1,429,204 C→T D52D (GAC→GAT stfR → putative prophage side tail fiber protein StfR
RA 1,429,207 T→G V53V (GTT→GTG stfR → putative prophage side tail fiber protein StfR
RA 1,429,225 C→T S59S (AGC→AGT stfR → putative prophage side tail fiber protein StfR
RA 1,429,228 T→C V60V (GTT→GTC stfR → putative prophage side tail fiber protein StfR
RA 1,429,231 T→C I61I (ATT→ATC stfR → putative prophage side tail fiber protein StfR
RA 1,429,235 2 bp→CA coding (187‑188/3363 nt) stfR → putative prophage side tail fiber protein StfR
RA 1,429,240 G→T V64V (GTG→GTT stfR → putative prophage side tail fiber protein StfR
RA 1,429,243 A→C E65D (GAA→GAC stfR → putative prophage side tail fiber protein StfR
RA 1,429,246 A→T G66G (GGA→GGT stfR → putative prophage side tail fiber protein StfR
RA 1,429,249 C→T F67F (TTC→TTT stfR → putative prophage side tail fiber protein StfR
RA 1,429,252 G→A P68P (CCG→CCA stfR → putative prophage side tail fiber protein StfR
RA 1,429,255 G→A P69P (CCG→CCA stfR → putative prophage side tail fiber protein StfR
RA 1,429,258 A→G S70S (TCA→TCG stfR → putative prophage side tail fiber protein StfR
RA 1,429,261 T→C H71H (CAT→CAC stfR → putative prophage side tail fiber protein StfR
RA 1,429,273 T→C I75I (ATT→ATC stfR → putative prophage side tail fiber protein StfR
RA 1,429,291 T→A S81S (TCT→TCA stfR → putative prophage side tail fiber protein StfR
RA 1,429,297 C→G P83P (CCC→CCG stfR → putative prophage side tail fiber protein StfR
RA 1,429,300 T→G G84G (GGT→GGG stfR → putative prophage side tail fiber protein StfR
RA 1,429,319 G→T G91C (GGT→TGT)  stfR → putative prophage side tail fiber protein StfR
RA 1,429,345 T→G R99R (CGT→CGG stfR → putative prophage side tail fiber protein StfR
RA 1,429,353 2 bp→TG coding (305‑306/3363 nt) stfR → putative prophage side tail fiber protein StfR
RA 1,429,360 C→T R104R (CGC→CGT stfR → putative prophage side tail fiber protein StfR
RA 1,429,364 T→C F106L (TTT→CTT)  stfR → putative prophage side tail fiber protein StfR
RA 1,429,404 C→T A119V (GCG→GTG)  stfR → putative prophage side tail fiber protein StfR
RA 1,429,416 2 bp→GT coding (368‑369/3363 nt) stfR → putative prophage side tail fiber protein StfR
RA 1,429,425 C→A A126D (GCC→GAC)  stfR → putative prophage side tail fiber protein StfR
RA 1,429,435 G→A K129K (AAG→AAA stfR → putative prophage side tail fiber protein StfR
RA 1,429,442 A→G S132G (AGT→GGC)  stfR → putative prophage side tail fiber protein StfR
RA 1,429,444 T→C S132G (AGT→GGC stfR → putative prophage side tail fiber protein StfR
RA 1,429,453 2 bp→TG coding (405‑406/3363 nt) stfR → putative prophage side tail fiber protein StfR
RA 1,429,462 3 bp→TGC coding (414‑416/3363 nt) stfR → putative prophage side tail fiber protein StfR
RA 1,429,466 G→C E140Q (GAG→CAG)  stfR → putative prophage side tail fiber protein StfR
RA 1,429,470 2 bp→TC coding (422‑423/3363 nt) stfR → putative prophage side tail fiber protein StfR
RA 1,429,474 2 bp→GG coding (426‑427/3363 nt) stfR → putative prophage side tail fiber protein StfR
RA 1,429,479 A→T H144L (CAT→CTT)  stfR → putative prophage side tail fiber protein StfR
RA 1,429,482 C→T A145V (GCG→GTG)  stfR → putative prophage side tail fiber protein StfR
RA 1,429,484 G→A A146T (GCT→ACT)  stfR → putative prophage side tail fiber protein StfR
RA 1,429,492 2 bp→AA coding (444‑445/3363 nt) stfR → putative prophage side tail fiber protein StfR
RA 1,429,495 G→T A149A (GCG→GCT stfR → putative prophage side tail fiber protein StfR
RA 1,429,510 A→C A154A (GCA→GCC stfR → putative prophage side tail fiber protein StfR
RA 1,429,522 A→C S158S (TCA→TCC stfR → putative prophage side tail fiber protein StfR
RA 1,429,534 C→T A162A (GCC→GCT stfR → putative prophage side tail fiber protein StfR
RA 1,429,537 G→A A163A (GCG→GCA stfR → putative prophage side tail fiber protein StfR
RA 1,429,543 G→A S165S (TCG→TCA stfR → putative prophage side tail fiber protein StfR
RA 1,429,550 2 bp→GA coding (502‑503/3363 nt) stfR → putative prophage side tail fiber protein StfR
RA 1,429,558 T→C S170S (TCT→TCC stfR → putative prophage side tail fiber protein StfR
RA 1,429,562 A→G S172G (AGC→GGC)  stfR → putative prophage side tail fiber protein StfR
RA 1,429,569 G→A G174E (GGA→GAA)  stfR → putative prophage side tail fiber protein StfR
RA 1,429,571 A→G T175A (ACG→GCG)  stfR → putative prophage side tail fiber protein StfR
RA 1,429,580 A→G T178A (ACA→GCA)  stfR → putative prophage side tail fiber protein StfR
RA 1,429,597 3 bp→GGA coding (549‑551/3363 nt) stfR → putative prophage side tail fiber protein StfR
RA 1,429,609 T→C A187A (GCT→GCC stfR → putative prophage side tail fiber protein StfR
RA 1,429,612 C→A A188A (GCC→GCA stfR → putative prophage side tail fiber protein StfR
RA 1,429,615 T→C A189A (GCT→GCC stfR → putative prophage side tail fiber protein StfR
RA 1,429,632 G→A S195N (AGC→AAC)  stfR → putative prophage side tail fiber protein StfR
RA 1,429,682 T→G S212A (TCA→GCA)  stfR → putative prophage side tail fiber protein StfR
RA 1,429,692 T→A L215Q (CTA→CAA)  stfR → putative prophage side tail fiber protein StfR
RA 1,429,702 A→C A218A (GCA→GCC stfR → putative prophage side tail fiber protein StfR
RA 1,429,708 A→G T220T (ACA→ACG stfR → putative prophage side tail fiber protein StfR
RA 1,429,714 A→C A222A (GCA→GCC stfR → putative prophage side tail fiber protein StfR
RA 1,429,724 A→G T226A (ACC→GCC)  stfR → putative prophage side tail fiber protein StfR
RA 1,429,732 G→A K228K (AAG→AAA stfR → putative prophage side tail fiber protein StfR
RA 1,429,735 A→G A229A (GCA→GCG stfR → putative prophage side tail fiber protein StfR
RA 1,429,741 A→G E231E (GAA→GAG stfR → putative prophage side tail fiber protein StfR
RA 1,429,744 T→C A232A (GCT→GCC stfR → putative prophage side tail fiber protein StfR
RA 1,429,747 G→C A233A (GCG→GCC stfR → putative prophage side tail fiber protein StfR
RA 1,429,750 C→T T234T (ACC→ACT stfR → putative prophage side tail fiber protein StfR
RA 1,429,753 G→A S235S (TCG→TCA stfR → putative prophage side tail fiber protein StfR
RA 1,429,756 C→A A236A (GCC→GCA stfR → putative prophage side tail fiber protein StfR
RA 1,429,759 G→A R237R (CGG→CGA stfR → putative prophage side tail fiber protein StfR
RA 1,429,767 C→T A240V (GCG→GTG)  stfR → putative prophage side tail fiber protein StfR
RA 1,429,780 A→G E244E (GAA→GAG stfR → putative prophage side tail fiber protein StfR
RA 1,429,783 G→A A245A (GCG→GCA stfR → putative prophage side tail fiber protein StfR
RA 1,429,816 C→T S256S (AGC→AGT stfR → putative prophage side tail fiber protein StfR
RA 1,429,820 A→G S258G (AGT→GGT)  stfR → putative prophage side tail fiber protein StfR
RA 1,429,823 A→C S259R (AGT→CGT)  stfR → putative prophage side tail fiber protein StfR
RA 1,429,851 G→A G268E (GGA→GAA)  stfR → putative prophage side tail fiber protein StfR
RA 1,429,858 C→T S270S (TCC→TCT stfR → putative prophage side tail fiber protein StfR
RA 1,429,861 G→C A271A (GCG→GCC stfR → putative prophage side tail fiber protein StfR
RA 1,429,863 A→G K272R (AAG→AGG)  stfR → putative prophage side tail fiber protein StfR
RA 1,429,888 C→T N280N (AAC→AAT stfR → putative prophage side tail fiber protein StfR
RA 1,429,897 T→A S283S (TCT→TCA stfR → putative prophage side tail fiber protein StfR
RA 1,453,992 G→A W22* (TGG→TGA paaA → phenylacetyl‑CoA 1,2‑epoxidase, monooxygenase subunit
RA 1,597,364 T→C intergenic (‑4922/+1253) hipB ← / ← lsrK antitoxin/DNA‑binding transcriptional repressor HipB/autoinducer‑2 kinase
RA 1,643,679 A→T L209Q (CTG→CAG)  ydfU ← protein YdfU
RA 1,652,331 T→C intergenic (+2346/+397) ydfD → / ← ynfP lysis protein/protein YnfP
RA 1,670,507 G→A W270* (TGG→TAG)  ynfM → putative transporter YnfM
JC 1,679,563 (TATCACGTTTTAATCACTGGATATCGATGGAAA)1→2 coding (7/1383 nt) ydgI → putative arginine:ornithine antiporter
RA 1,721,136 C→T L38F (CTT→TTT)  ydhI → DUF1656 domain‑containing protein YdhI
RA 1,776,100 G→A E172K (GAA→AAA)  ydiF → putative acetate‑CoA transferase YdiF
RA 1,776,715 A→T S377C (AGT→TGT)  ydiF → putative acetate‑CoA transferase YdiF
RA 1,894,839 T→C L12P (CTC→CCC)  pabB → aminodeoxychorismate synthase subunit 1
RA 1,955,010 G→A D666D (GAC→GAT torZ ← trimethylamine N‑oxide reductase 2
MC JC 1,978,503 Δ776 bp insB5insA5 insB5, insA5
RA 1,994,637 A→G Y24H (TAC→CAC)  uvrC ← UvrABC excision nuclease subunit C
RA 2,040,433 C→A A319D (GCC→GAC)  msrP → protein‑L‑methionine sulfoxide reductase catalytic subunit MsrP
RA 2,041,411 G→A G13S (GGT→AGT)  zinT → metal‑binding protein ZinT
RA 2,046,506 G→T V523V (GTG→GTT yeeJ → inverse autotransporter adhesin
RA 2,085,319 G→A A69A (GCC→GCT tsuA ← thiosulfate transporter
RA 2,086,634 G→A A143A (GCC→GCT plaP ← putrescine:H(+) symporter PlaP
RA 2,103,891 G→A P207S (CCA→TCA)  wbbK ← putative glycosyltransferase WbbK
RA 2,111,259 Δ1 bp coding (718/900 nt) rfbD ← dTDP‑4‑dehydrorhamnose reductase
RA 2,122,908 G→A I24I (ATC→ATT cpsG ← phosphomannomutase
RA 2,134,498 G→A V385V (GTC→GTT wzc ← protein‑tyrosine kinase Wzc
RA 2,137,543 G→A intergenic (‑300/‑359) wza ← / → yegH outer membrane polysaccharide export protein Wza/inner membrane protein YegH
RA 2,173,363 Δ2 bp intergenic (‑490/+918) gatD ← / ← gatB galactitol‑1‑phosphate 5‑dehydrogenase/galactitol‑specific PTS enzyme IIB component
RA 2,173,448 C→T intergenic (‑575/+834) gatD ← / ← gatB galactitol‑1‑phosphate 5‑dehydrogenase/galactitol‑specific PTS enzyme IIB component
JC JC 2,174,359 IS5 (+) +4 bp coding (205‑208/285 nt) gatB ← galactitol‑specific PTS enzyme IIB component
RA 2,188,087 T→C T110A (ACG→GCG)  yehA ← putative fimbrial adhesin YehA
RA 2,329,209 A→G W197R (TGG→CGG)  yfaQ ← tandem DUF2300 domain‑containing protein YfaQ
RA 2,339,162 C→T D87N (GAC→AAC)  gyrA ← DNA gyrase subunit A
JC JC 2,378,926 IS5 (–) +4 bp coding (331‑334/1671 nt) menD ← 2‑succinyl‑5‑enolpyruvyl‑6‑hydroxy‑3‑ cyclohexene‑1‑carboxylate synthase
RA 2,384,808 C→T K305K (AAG→AAA yfbK ← IPR002035/DUF3520 domain‑containing protein YfbK
RA 2,410,419 G→A L312L (CTG→TTG)  yfbS ← putative transporter YfbS
RA 2,484,827 C→T L152F (CTT→TTT)  evgS → sensor histidine kinase EvgS
RA 2,510,609 C→T P327L (CCG→CTG)  yfeO → putative transport protein YfeO
RA 2,518,092 G→T noncoding (25/76 nt) alaX ← tRNA‑Ala
MC JC 2,558,699 Δ6,790 bp intZ[eutA] intZ, yffL, yffM, yffN, yffO, yffP, yffQ, yffR, yffS, [eutA]
RA 2,587,112 C→T A461V (GCA→GTA)  narQ → sensor histidine kinase NarQ
RA 2,732,992 G→A I394I (ATC→ATT
I394I (ATC→ATT
clpB ←
clpB ←
chaperone protein ClpB
chaperone protein ClpB
RA 2,823,537 A→G L78P (CTG→CCG)  recA ← DNA recombination/repair protein RecA
RA 2,856,243 A→G T636A (ACG→GCG)  fhlA → DNA‑binding transcriptional activator FhlA
RA 2,867,454 T→A Q33L (CAG→CTG)  rpoS ← RNA polymerase sigma factor RpoS
RA 2,871,153 T→G N51T (AAC→ACC)  truD ← tRNA pseudouridine(13) synthase
RA 2,926,543 2 bp→TT coding (236‑237/1365 nt) ppnN → nucleotide 5'‑monophosphate nucleosidase
RA 2,926,772 C→A G155G (GGC→GGA ppnN → nucleotide 5'‑monophosphate nucleosidase
JC JC 2,993,231 IS5 (–) +4 bp coding (1138‑1141/1377 nt) ygeH → putative transcriptional regulator YgeH
RA 3,028,546 G→A A156V (GCC→GTC)  ygfS ← putative electron transport protein YgfS
RA 3,050,472 G→A L66L (CTG→TTG)  gcvT ← aminomethyltransferase
RA 3,061,916 C→T A356V (GCC→GTC)  scpA → methylmalonyl‑CoA mutase
RA 3,065,449 G→A L216L (TTG→TTA scpC → propionyl‑CoA:succinate CoA transferase
RA 3,065,861 G→A V354I (GTC→ATC)  scpC → propionyl‑CoA:succinate CoA transferase
RA 3,089,260 T→C V326A (GTG→GCG)  galP → galactose:H(+) symporter
RA 3,090,968 G→A E208K (GAG→AAG)  endA → DNA‑specific endonuclease I
RA 3,104,887 G→A S152N (AGC→AAC)  mltC → membrane‑bound lytic murein transglycosylase C
RA 3,120,786 G→A T165I (ACT→ATT)  glcA ← glycolate/lactate:H(+) symporter GlcA
RA 3,121,033 T→C I83V (ATT→GTT)  glcA ← glycolate/lactate:H(+) symporter GlcA
RA 3,127,981 G→A P14L (CCC→CTC)  glcD ← glycolate dehydrogenase, putative FAD‑linked subunit
RA 3,130,161 G→A L19F (CTT→TTT)  yghO ← putative DNA‑binding transcriptional regulator YghO
RA 3,132,077 G→A A111V (GCG→GTG)  yghQ ← putative transport protein YghQ
RA 3,133,175 G→A T13I (ACC→ATC)  yghR ← putative ATP‑binding protein YghR
RA 3,134,263 G→A A45T (GCC→ACC)  yghT → putative ATP‑binding protein YghT
RA 3,145,944 G→A L106L (CTC→CTT hybO ← hydrogenase 2 small subunit
RA 3,150,316 G→A E219K (GAG→AAG)  yghA → NADP(+)‑dependent aldehyde reductase
RA 3,162,216 G→A Q152* (CAG→TAG)  ftsP ← cell division protein FtsP
RA 3,176,625 G→A S70F (TCC→TTC)  cpdA ← cAMP phosphodiesterase
RA 3,179,383 G→A K423K (AAG→AAA tolC → outer membrane channel TolC
RA 3,186,297 G→A R37R (CGG→CGA insC5 → IS2 insertion element repressor InsA
RA 3,193,351 G→A G163E (GGG→GAG)  yqiK → flotillin family inner membrane protein YqiK
RA 3,204,617 G→A intergenic (‑28/‑77) folB ← / → plsY dihydroneopterin aldolase/putative glycerol‑3‑phosphate acyltransferase
RA 3,207,549 Δ1 bp coding (179/606 nt) ttdB → L(+)‑tartrate dehydratase subunit beta
RA 3,219,128 G→A intergenic (‑52/‑366) aer ← / → patA aerotaxis receptor/putrescine aminotransferase
RA 3,224,895 C→T L755L (CTG→TTG)  ebgA → evolved beta‑D‑galactosidase subunit alpha
RA 3,227,339 C→T T369I (ACC→ATC)  ygjI → putative transporter YgjI
RA 3,240,423 C→T G160G (GGC→GGT sstT → serine/threonine:Na(+) symporter
RA 3,256,157 C→T Q165Q (CAG→CAA cyuA ← putative L‑cysteine desulfidase CyuA
RA 3,259,283 G→A H123Y (CAT→TAT)  tdcG ← L‑serine deaminase III
RA 3,270,497 C→T noncoding (96/377 nt) rnpB ← RNase P catalytic RNA component
RA 3,275,902 A→T E207D (GAA→GAT garD → GarD
RA 3,292,312 C→T P324P (CCC→CCT yraK → putative fimbrial adhesin YraK
RA 3,304,647 T→C I391V (ATT→GTT)  mtr ← tryptophan:H(+) symporter Mtr
RA 3,329,743 G→T D261Y (GAT→TAT)  dacB → peptidoglycan DD‑endopeptidase DacB
JC JC 3,368,685 IS2 (–) +5 bp coding (859‑863/1128 nt) yhcG → DUF1016 domain‑containing protein YhcG
RA 3,377,240 T→G T61P (ACC→CCC)  sspA ← stringent starvation protein A
RA 3,388,041 T→G T50P (ACG→CCG)  aaeB ← aromatic carboxylic acid efflux pump subunit AaeB
RA 3,506,393 T→C D315G (GAC→GGC)  yhfT ← uncharacterized protein YhfT
RA 3,524,184 C→T A438A (GCC→GCT mrcA → peptidoglycan glycosyltransferase/peptidoglycan DD‑transpeptidase MrcA
RA 3,558,291 C→T G8G (GGC→GGT rtcR → DNA‑binding transcriptional activator RtcR
RA 3,559,621 C→T P452S (CCC→TCC)  rtcR → DNA‑binding transcriptional activator RtcR
RA 3,560,119 A→G intergenic (+253/+503) rtcR → / ← glpG DNA‑binding transcriptional activator RtcR/rhomboid protease GlpG
RA 3,560,455 +G intergenic (+589/+167) rtcR → / ← glpG DNA‑binding transcriptional activator RtcR/rhomboid protease GlpG
RA 3,579,050 G→A A199V (GCC→GTC)  yhhW ← quercetin 2,3‑dioxygenase
RA 3,581,316 G→A G60E (GGA→GAA)  yhhY → N‑acetyltransferase YhhY
RA 3,581,850 G→A intergenic (+224/‑13) yhhY → / → yhhZ N‑acetyltransferase YhhY/putative endonuclease YhhZ
RA 3,583,969 G→A W98* (TGG→TAG)  insB6 → IS1 family protein InsB
RA 3,585,517 G→A A436V (GCC→GTC)  ggt ← glutathione hydrolase proenzyme
RA 3,587,531 G→A L195F (CTC→TTC)  ugpQ ← glycerophosphodiester phosphodiesterase UgpQ
RA 3,588,787 G→A P132S (CCG→TCG)  ugpC ← sn‑glycerol 3‑phosphate ABC transporter ATP binding subunit
RA 3,589,956 G→A L24L (CTC→CTT ugpE ← sn‑glycerol 3‑phosphate ABC transporter membrane subunit UgpE
RA 3,621,090 C→T R633R (CGC→CGT rhsB → rhs element protein RhsB
RA 3,647,677 C→T intergenic (+26/+28) gor → / ← dinQ glutathione reductase (NADPH)/membrane toxin DinQ
RA 3,707,947 C→A intergenic (‑242/+669) dppA ← / ← proK dipeptide ABC transporter periplasmic binding protein/tRNA‑Pro
RA 3,725,176 T→G E48A (GAG→GCG)  glyQ ← glycine‑‑tRNA ligase subunit alpha
RA 3,815,883 +C coding (667/687 nt) rph ← truncated RNase PH
RA 3,827,026 C→T A606V (GCG→GTG)  recG → ATP‑dependent DNA helicase RecG
RA 3,927,292 T→C D46D (GAT→GAC asnA → asparagine synthetase A
RA 3,937,909 G→A A206T (GCG→ACG)  rbsK → ribokinase
RA 3,937,997 G→A G235D (GGT→GAT)  rbsK → ribokinase
RA 3,938,441 Δ1 bp coding (215/993 nt) rbsR → DNA‑binding transcriptional dual regulator RbsR
RA 3,941,874 C→T noncoding (67/1542 nt) rrsC → 16S ribosomal RNA
RA 3,946,246 G→A noncoding (2543/2904 nt) rrlC → 23S ribosomal RNA
RA 3,950,099 C→T intergenic (‑130/‑223) yifB ← / → ilvL putative magnesium chelatase YifB/ilvXGMEDA operon leader peptide
RA 3,956,003 G→A D225N (GAT→AAT)  ilvA → threonine deaminase
RA 4,084,932 G→T F297L (TTC→TTA fdoG ← formate dehydrogenase O subunit alpha
RA 4,139,298 G→A A137A (GCC→GCT fsaB ← fructose‑6‑phosphate aldolase 2
RA 4,160,157 G→A L212L (CTG→TTG)  sthA ← soluble pyridine nucleotide transhydrogenase
RA 4,175,827 C→T noncoding (74/76 nt) thrT → tRNA‑Thr
RA 4,178,883 C→T A2V (GCT→GTT)  rplA → 50S ribosomal subunit protein L1
RA 4,179,001 C→T S41S (AGC→AGT rplA → 50S ribosomal subunit protein L1
RA 4,185,777 C→T S143F (TCC→TTC)  rpoC → RNA polymerase subunit beta'
RA 4,193,177 C→T E134K (GAG→AAG)  thiF ← sulfur carrier protein ThiS adenylyltransferase
RA 4,193,820 C→T G129R (GGA→AGA)  thiE ← thiamine phosphate synthase
RA 4,219,752 C→T S386F (TCC→TTC)  aceK → isocitrate dehydrogenase kinase/phosphatase
RA 4,222,743 C→T intergenic (‑256/+61) arpA ← / ← iclR regulator of acetyl CoA synthetase/DNA‑binding transcriptional repressor IclR
RA 4,223,638 T→C intergenic (‑10/‑190) iclR ← / → metH DNA‑binding transcriptional repressor IclR/cobalamin‑dependent methionine synthase
RA 4,224,483 C→T S219F (TCC→TTC)  metH → cobalamin‑dependent methionine synthase
RA 4,234,479 C→T A241V (GCG→GTG)  pgi → glucose‑6‑phosphate isomerase
RA 4,249,684 C→T A44V (GCT→GTT)  malM → maltose regulon periplasmic protein
RA 4,265,668 C→T T452I (ACC→ATC)  dnaB → replicative DNA helicase
RA 4,269,449 C→T C12C (TGC→TGT aphA → acid phosphatase/phosphotransferase
RA 4,271,130 C→T E914E (GAG→GAA uvrA ← UvrABC excision nuclease subunit A
RA 4,278,488 C→T P4S (CCA→TCA)  ghxP → guanine/hypoxanthine transporter GhxP
RA 4,282,536 C→T Q180Q (CAG→CAA yjcF ← pentapeptide repeat‑containing protein YjcF
RA 4,284,077 C→T A276T (GCG→ACG)  actP ← acetate/glycolate:cation symporter
RA 4,286,033 C→T A447T (GCG→ACG)  acs ← acetyl‑CoA synthetase (AMP‑forming)
RA 4,296,187 C→T intergenic (+393/+249) gltP → / ← yjcO glutamate/aspartate : H(+) symporter GltP/Sel1 repeat‑containing protein YjcO
RA 4,296,300 C→T intergenic (+506/+136) gltP → / ← yjcO glutamate/aspartate : H(+) symporter GltP/Sel1 repeat‑containing protein YjcO
RA 4,296,381 +GC intergenic (+587/+55) gltP → / ← yjcO glutamate/aspartate : H(+) symporter GltP/Sel1 repeat‑containing protein YjcO
RA 4,297,469 C→T G633D (GGC→GAC)  fdhF ← formate dehydrogenase H
RA 4,298,199 C→T A390T (GCA→ACA)  fdhF ← formate dehydrogenase H
RA 4,301,071 C→T A670T (GCA→ACA)  mdtO ← putative multidrug efflux pump subunit MdtO
RA 4,303,755 C→T V119I (GTT→ATT)  mdtN ← putative multidrug efflux pump membrane fusion protein
RA 4,311,337 C→T A236T (GCA→ACA)  alsB ← D‑allose ABC transporter periplasmic binding protein
RA 4,320,079 C→T Q195Q (CAG→CAA phnI ← carbon‑phosphorus lyase core complex subunit PhnI
RA 4,320,785 C→T E155K (GAG→AAG)  phnH ← carbon‑phosphorus lyase core complex subunit PhnH
RA 4,322,605 C→T intergenic (‑183/+731) phnF ← / ← phnD putative transcriptional regulator PhnF/phosphonate/phosphate ABC transporter periplasmic binding protein
RA 4,325,644 C→T S33N (AGC→AAC)  yjdN ← PF06983 family protein YjdN
RA 4,325,837 C→T intergenic (‑96/+562) yjdN ← / ← yjdM PF06983 family protein YjdN/zinc ribbon domain‑containing protein YjdM
RA 4,332,310 C→T G321G (GGG→GGA basS ← sensor histidine kinase BasS
RA 4,337,864 C→T V22V (GTG→GTA adiY ← DNA‑binding transcriptional activator AdiY
RA 4,342,825 C→T N305N (AAC→AAT melA → alpha‑galactosidase
RA 4,349,259 C→T intergenic (‑515/+56) dcuB ← / ← dcuR anaerobic C4‑dicarboxylate transporter DcuB/DNA‑binding transcriptional activator DcuR
RA 4,351,519 C→T T48T (ACG→ACA dcuS ← sensor histidine kinase DcuS
RA 4,351,590 C→T V25I (GTC→ATC)  dcuS ← sensor histidine kinase DcuS
RA 4,359,909 C→T W41* (TGG→TGA cadB ← lysine:cadaverine antiporter
RA 4,364,798 C→T G82D (GGC→GAC)  dsbD ← thiol‑disulfide exchange protein DsbD
RA 4,366,668 C→T A36T (GCC→ACC)  dcuA ← C4‑dicarboxylate transporter DcuA
RA 4,371,401 C→T A126V (GCT→GTT)  groL → chaperonin GroEL
RA 4,373,421 C→T A272T (GCG→ACG)  yjeJ ← protein YjeJ
RA 4,380,469 C→T E17K (GAA→AAA)  frdB ← fumarate reductase iron‑sulfur protein
RA 4,388,120 C→T A417A (GCG→GCA mscM ← miniconductance mechanosensitive channel MscM
RA 4,389,838 C→T V175M (GTG→ATG)  psd ← phosphatidylserine decarboxylase proenzyme
RA 4,401,607 C→T T312T (ACC→ACT hflX → ribosome rescue factor HflX
RA 4,403,010 C→T R325C (CGT→TGT)  hflK → regulator of FtsH protease
RA 4,407,045 C→T A131V (GCT→GTT)  rnr → RNase R
RA 4,414,625 C→T R117R (CGC→CGT aidB → putative acyl‑CoA dehydrogenase AidB
RA 4,418,862 C→T G255D (GGT→GAT)  ulaG ← L‑ascorbate‑6‑phosphate lactonase
RA 4,426,929 C→T C165Y (TGC→TAC)  yjfZ ← DUF2686 domain‑containing protein YjfZ
RA 4,433,459 C→T G189D (GGC→GAC)  qorB ← NAD(P)H:quinone oxidoreductase
JC JC 4,434,629 IS1 (–) +8 bp coding (1930‑1937/1944 nt) cpdB ← 2',3'‑cyclic‑nucleotide 2'‑phosphodiesterase/3'‑nucleotidase
RA 4,435,124 C→T W481* (TGG→TAG)  cpdB ← 2',3'‑cyclic‑nucleotide 2'‑phosphodiesterase/3'‑nucleotidase
RA 4,435,750 C→T G272G (GGG→GGA cpdB ← 2',3'‑cyclic‑nucleotide 2'‑phosphodiesterase/3'‑nucleotidase
RA 4,451,280 C→T P75S (CCG→TCG)  ytfR → galactofuranose ABC transporter putative ATP binding subunit
RA 4,457,392 C→T E158E (GAG→GAA yjgA ← putative ribosome biogenesis factor YjgA
RA 4,482,901 C→T V313M (GTG→ATG)  valS ← valine‑‑tRNA ligase
RA 4,486,869 T→A L218M (TTG→ATG)  lptF → lipopolysaccharide transport system protein LptF
RA 4,487,022 C→T R269C (CGT→TGT)  lptF → lipopolysaccharide transport system protein LptF
RA 4,489,775 C→T V97M (GTG→ATG)  yjgR ← DUF853 domain‑containing protein YjgR
RA 4,494,499 C→T intergenic (‑93/‑124) idnD ← / → idnK L‑idonate 5‑dehydrogenase/D‑gluconate kinase, thermosensitive
RA 4,501,500 C→T L81L (CTG→TTG)  yjgZ → uncharacterized protein YjgZ
RA 4,510,238 T→G intergenic (+445/+452) insO → / ← fecE IS911B regulator fragment/ferric citrate ABC transporter ATP binding subunit
RA 4,517,355 C→T Q121Q (CAG→CAA fecR ← ferric citrate regulator FecR
RA 4,524,401 C→T G204S (GGC→AGC)  yjhH ← putative 2‑dehydro‑3‑deoxy‑D‑pentonate aldolase
RA 4,524,596 C→T D139N (GAT→AAT)  yjhH ← putative 2‑dehydro‑3‑deoxy‑D‑pentonate aldolase
RA 4,529,039 C→T G402D (GGT→GAT)  sgcC ← putative PTS enzyme IIC component SgcC
RA 4,530,797 C→T Q285Q (CAG→CAA sgcX ← putative endoglucanase with Zn‑dependent exopeptidase domain
RA 4,541,261 C→T A102V (GCT→GTT)  fimB → Type 1 fimbriae regulatory protein FimB
JC JC 4,542,042 IS1 (+) +8 bp coding (6‑13/597 nt) fimE → regulator for fimA
RA 4,553,671 C→T F257F (TTC→TTT uxuB → D‑mannonate oxidoreductase
RA 4,564,385 C→T S102N (AGC→AAC)  yjiL ← putative ATPase, activator of (R)‑hydroxyglutaryl‑CoA dehdratase
RA 4,570,550 C→T S342N (AGC→AAC)  yjiR ← fused putative DNA‑binding transcriptional regulator/putative aminotransferase YjiR
RA 4,571,280 C→T E99K (GAG→AAG)  yjiR ← fused putative DNA‑binding transcriptional regulator/putative aminotransferase YjiR
RA 4,585,673 C→T W363* (TGG→TGA hsdR ← type I restriction enzyme EcoKI endonuclease subunit
RA 4,587,365 C→T S139S (AGC→AGT mrr → Type IV methyl‑directed restriction enzyme EcoKMrr
RA 4,604,517 C→T L120L (CTG→TTG)  bglJ → DNA‑binding transcriptional regulator BglJ
RA 4,636,925 G→C R77P (CGC→CCC)  creC → sensory histidine kinase CreC
RA 4,638,240 G→A L21L (TTG→TTA creD → putative inner membrane protein CreD

Unassigned missing coverage evidence
   seq id start end size ←reads reads→ gene description
* * ÷ NC_000913 565829 566071 243 28 [0] [0] 4 [intD] [intD]
* * ÷ NC_000913 566378 566399 22 3 [0] [2] 3 intD/renD putative integrase/protein RenD
* * ÷ NC_000913 568132 577187 9056 3 [2] [0] 28 [renD]–nmpC [renD],emrE,ylcJ,ybcK,ybcL,ybcM,ylcH,ybcN,ninE,ybcO,rusA,ylcG,quuD,nmpC,insH2,nmpC
* * ÷ NC_000913 1196375 1211415 15041 3 [0] [2] 4 C0293–mcrA C0293,ymfD,ymfE,lit,intE,xisE,ymfH,ymfI,ymfJ,ymfK,ymfT,ymfL,ymfM,ymfN,ymfR,beeE,ymfQ,ycfK,tfaP,tfaE,pinE,mcrA
* * ÷ NC_000913 1411925 1423199 11275 17 [0] [0] 4 [ttcA]–[ydaW] [ttcA],intR,xisR,rcbA,ralA,ralR,recT,recE,racC,ydaE,kilR,kilS,sieB,ydaF,ydaG,racR,ydaS,ydaT,ydaU,ydaV,[ydaW]
* * ÷ NC_000913 1423549–1423569 1428908 5340–5360 3 [1] [2] 3 [rzoR]–[lomR] [rzoR],trkG,ynaK,ydaY,ynaA,lomR,insH5,[lomR]
* * ÷ NC_000913 1429927 1434968 5042 3 [2] [2] 3 [stfR]–ynaM [stfR],tfaR,pinR,ynaE,ynaM
* * ÷ NC_000913 3423881–3424234 3424429–3424238 5–549 3 [2] [2] 3 rrlD 23S ribosomal RNA

Unassigned new junction evidence
  seq id position reads (cov) reads (cov) score skew freq annotation gene product
* ? NC_000913 = 24954547 (1.240)33 (0.890) 32/474 0.2 38.5% intergenic (+1411/‑1353) rayT/dinB REP‑associated tyrosine transposase/DNA polymerase IV
?NC_000913 373870 = 60 (1.630)coding (950/951 nt)
coding (3/1014 nt)
mhpF
mhpE
acetaldehyde dehydrogenase (acetylating) MhpF
4‑hydroxy‑2‑oxovalerate aldolase
* ? NC_000913 273955 =NA (NA)28 (0.740) 28/488 0.4 100% noncoding (1195/1195 nt) IS5 repeat region
?NC_000913 = 565828 0 (0.000)coding (151/1164 nt) intD putative integrase
* ? NC_000913 = 275149NA (NA)28 (0.740) 23/488 0.5 100% noncoding (1/1195 nt) IS5 repeat region
?NC_000913 577188 = 0 (0.000)intergenic (‑363/‑210) nmpC/essD putative outer membrane porin NmpC/putative phage lysis protein
* ? NC_000913 = 36618044 (1.160)47 (1.240) 44/488 0.1 55.0% coding (126/3075 nt) lacZ beta‑galactosidase
?NC_000913 366274 = 33 (0.870)coding (32/3075 nt) lacZ beta‑galactosidase
* ? NC_000913 = 5667740 (0.000)12 (0.320) 9/484 1.7 100% pseudogene (91/93 nt) renD protein RenD
?NC_000913 568036 = 0 (0.000)pseudogene (2/213 nt) renD protein RenD
* ? NC_000913 = 14119240 (0.000)17 (0.500) 17/436 0.7 100% coding (25/936 nt) ttcA tRNA cytosine(32) 2‑sulfurtransferase TtcA
?NC_000913 1434985 = 0 (0.000)intergenic (‑579/+200) ynaM/uspF protein YnaM/universal stress protein F