mutation predictions | marginal predictions | summary statistics | genome diff | command line log
|
breseq version 0.39.0
mutation predictions | marginal predictions | summary statistics | genome diff | command line log |
| Predicted mutations | |||||
|---|---|---|---|---|---|
| evidence | position | mutation | annotation | gene | description |
| JC JC | 16,974 | IS150 (–) +3 bp | noncoding (23‑25/59 nt) | sokC → | small regulatory RNA antitoxin SokC |
| RA | 23,501 | C→T | L371L (CTG→TTG) | ileS → | isoleucine‑‑tRNA ligase |
| RA | 31,683 | C→T | N289N (AAC→AAT) | carB → | carbamoyl‑phosphate synthetase large subunit |
| RA | 42,108 | G→A | intergenic (‑177/‑295) | caiT ← / → fixA | L‑carnitine:gamma‑butyrobetaine antiporter/putative electron transfer flavoprotein FixA |
| RA | 59,968 | C→T | V127I (GTC→ATC) | rluA ← | 23S rRNA pseudouridine(746) and tRNA pseudouridine(32) synthase |
| RA | 88,571 | G→A | V182M (GTG→ATG) | cra → | DNA‑binding transcriptional dual regulator Cra |
| RA | 246,747 | G→T | S12S (TCG→TCT) | yafL → | NlpC/P60 family protein YafL |
| MC JC | 257,908 | Δ776 bp | insB9–[crl] | insB9, insA9, [crl] | |
| RA | 284,535 | T→G | A445A (GCT→GCG) | yagF → | D‑xylonate dehydratase |
| RA | 313,543 | G→A | intergenic (‑301/‑1748) | ykgR ← / → insE1 | putative membrane protein YkgR/IS3 element protein InsE |
| RA | 367,573 | G→A | intergenic (‑63/+14) | lacI ← / ← mhpR | DNA‑binding transcriptional repressor LacI/DNA‑binding transcriptional activator MhpR |
| JC JC | 458,790 | IS186 (–) +6 bp :: Δ1 bp | intergenic (+90/‑93) | clpX → / → lon | ATP‑dependent Clp protease ATP‑binding subunit ClpX/Lon protease |
| RA | 466,148 | G→A | P389S (CCA→TCA) | ybaE ← | uncharacterized protein YbaE |
| RA | 469,271 | G→A | G134E (GGG→GAG) | mdlA → | ABC transporter family protein MdlA |
| RA | 480,295 | 2 bp→AA | coding (13‑14/219 nt) | hha ← | hemolysin expression‑modulating protein Hha |
| RA | 502,232 | G→A | T336I (ACC→ATC) | ybaL ← | putative transporter YbaL |
| RA | 566,173 | C→G | intergenic (‑195/‑511) | intD ← / → renD | putative integrase/protein RenD |
| RA | 566,205 | T→C | intergenic (‑227/‑479) | intD ← / → renD | putative integrase/protein RenD |
| RA | 566,245 | G→A | intergenic (‑267/‑439) | intD ← / → renD | putative integrase/protein RenD |
| RA | 566,277 | C→T | intergenic (‑299/‑407) | intD ← / → renD | putative integrase/protein RenD |
| RA | 566,323 | C→T | intergenic (‑345/‑361) | intD ← / → renD | putative integrase/protein RenD |
| RA | 566,326 | T→C | intergenic (‑348/‑358) | intD ← / → renD | putative integrase/protein RenD |
| RA | 566,332 | T→G | intergenic (‑354/‑352) | intD ← / → renD | putative integrase/protein RenD |
| RA | 566,356 | T→C | intergenic (‑378/‑328) | intD ← / → renD | putative integrase/protein RenD |
| RA | 566,463 | T→C | intergenic (‑485/‑221) | intD ← / → renD | putative integrase/protein RenD |
| RA | 566,468 | C→T | intergenic (‑490/‑216) | intD ← / → renD | putative integrase/protein RenD |
| RA | 566,492 | 2 bp→TA | intergenic (‑514/‑191) | intD ← / → renD | putative integrase/protein RenD |
| RA | 566,498 | C→T | intergenic (‑520/‑186) | intD ← / → renD | putative integrase/protein RenD |
| RA | 566,510 | G→C | intergenic (‑532/‑174) | intD ← / → renD | putative integrase/protein RenD |
| RA | 566,513 | C→T | intergenic (‑535/‑171) | intD ← / → renD | putative integrase/protein RenD |
| RA | 566,519 | T→C | intergenic (‑541/‑165) | intD ← / → renD | putative integrase/protein RenD |
| RA | 566,522 | C→A | intergenic (‑544/‑162) | intD ← / → renD | putative integrase/protein RenD |
| RA | 566,528 | A→G | intergenic (‑550/‑156) | intD ← / → renD | putative integrase/protein RenD |
| RA | 566,530 | +T | intergenic (‑552/‑154) | intD ← / → renD | putative integrase/protein RenD |
| RA | 566,532 | A→T | intergenic (‑554/‑152) | intD ← / → renD | putative integrase/protein RenD |
| RA | 566,535 | 2 bp→A | intergenic (‑557/‑148) | intD ← / → renD | putative integrase/protein RenD |
| RA | 566,543 | A→T | intergenic (‑565/‑141) | intD ← / → renD | putative integrase/protein RenD |
| RA | 566,547 | C→A | intergenic (‑569/‑137) | intD ← / → renD | putative integrase/protein RenD |
| RA | 566,565 | A→G | intergenic (‑587/‑119) | intD ← / → renD | putative integrase/protein RenD |
| RA | 566,570 | A→C | intergenic (‑592/‑114) | intD ← / → renD | putative integrase/protein RenD |
| RA | 566,597 | T→C | intergenic (‑619/‑87) | intD ← / → renD | putative integrase/protein RenD |
| RA | 566,651 | T→C | intergenic (‑673/‑33) | intD ← / → renD | putative integrase/protein RenD |
| RA | 566,728 | G→T | pseudogene (45/93 nt) | renD → | protein RenD |
| RA | 566,740 | A→G | pseudogene (57/93 nt) | renD → | protein RenD |
| RA | 566,742 | A→C | pseudogene (59/93 nt) | renD → | protein RenD |
| RA | 566,756 | G→C | pseudogene (73/93 nt) | renD → | protein RenD |
| RA | 566,770 | C→A | pseudogene (87/93 nt) | renD → | protein RenD |
| RA | 568,052 | T→C | pseudogene (18/213 nt) | renD → | protein RenD |
| RA | 568,067 | G→A | pseudogene (33/213 nt) | renD → | protein RenD |
| RA | 568,076 | 2 bp→TC | pseudogene (42‑43/213 nt) | renD → | protein RenD |
| RA | 568,079 | C→T | pseudogene (45/213 nt) | renD → | protein RenD |
| RA | 568,085 | 2 bp→TA | pseudogene (51‑52/213 nt) | renD → | protein RenD |
| RA | 568,088 | T→C | pseudogene (54/213 nt) | renD → | protein RenD |
| RA | 568,091 | T→A | pseudogene (57/213 nt) | renD → | protein RenD |
| RA | 662,269 | C→T | D4N (GAT→AAT) | lipB ← | lipoyl(octanoyl) transferase |
| RA | 696,470 | C→T | noncoding (35/75 nt) | glnX ← | tRNA‑Gln |
| RA | 784,677 | G→A | A49A (GCC→GCT) | zitB ← | Zn(2(+))/Cd(2(+))/Ni(2(+))/Cu(2(+)) exporter |
| RA | 968,837 | G→A | D158N (GAT→AAT) | lpxK → | tetraacyldisaccharide 4'‑kinase |
| RA | 1,040,126 | G→T | L277L (CTG→CTT) | appB → | cytochrome bd‑II subunit 2 |
| RA | 1,061,935 | G→A | S46N (AGC→AAC) | torD → | trimethylamine‑N‑oxide reductase‑specific chaperone |
| RA | 1,069,743 | C→T | A33T (GCA→ACA) | rutG ← | pyrimidine:H(+) symporter |
| RA | 1,098,620 | T→A | V245V (GTT→GTA) | ghrA → | glyoxylate/hydroxypyruvate reductase A |
| RA | 1,111,727 | 2 bp→TT | coding (865‑866/2544 nt) | opgH → | osmoregulated periplasmic glucans biosynthesis protein H |
| RA | 1,156,913 | G→A | G46D (GGT→GAT) | ycfH → | putative metal‑dependent hydrolase YcfH |
| RA | 1,169,836 | A→G | L180P (CTG→CCG) | ldtC ← | L,D‑transpeptidase LdtC |
| RA | 1,189,980 | A→G | T156T (ACT→ACC) | phoP ← | DNA‑binding transcriptional dual regulator PhoP |
| RA | 1,196,220 | C→T | H366H (CAC→CAT) | icd → | isocitrate dehydrogenase |
| RA | 1,196,232 | C→T | T370T (ACC→ACT) | icd → | isocitrate dehydrogenase |
| RA | 1,196,245 | T→C | L375M (TTA→CTG) | icd → | isocitrate dehydrogenase |
| RA | 1,196,247 | A→G | L375M (TTA→CTG) | icd → | isocitrate dehydrogenase |
| RA | 1,196,277 | C→T | N385N (AAC→AAT) | icd → | isocitrate dehydrogenase |
| RA | 1,196,280 | G→C | A386A (GCG→GCC) | icd → | isocitrate dehydrogenase |
| RA | 1,196,283 | A→G | K387K (AAA→AAG) | icd → | isocitrate dehydrogenase |
| RA | 1,196,292 | C→T | T390T (ACC→ACT) | icd → | isocitrate dehydrogenase |
| RA | 1,196,304 | G→A | E394E (GAG→GAA) | icd → | isocitrate dehydrogenase |
| RA | 1,196,316 | T→A | D398E (GAT→GAA) | icd → | isocitrate dehydrogenase |
| MC JC | 1,299,499 | Δ1,199 bp | insH21 | insH21 | |
| RA | 1,301,992 | A→T | N271Y (AAT→TAT) | oppA → | oligopeptide ABC transporter periplasmic binding protein |
| RA | 1,302,454 | Δ1 bp | coding (1273/1632 nt) | oppA → | oligopeptide ABC transporter periplasmic binding protein |
| RA | 1,306,736 | T→G | S325A (TCC→GCC) | oppF → | murein tripeptide ABC transporter/oligopeptide ABC transporter ATP binding subunit OppF |
| RA | 1,310,770 | A→G | H32H (CAT→CAC) | yciI ← | protein YciI |
| RA | 1,322,759 | G→A | A63V (GCT→GTT) | trpE ← | anthranilate synthase subunit TrpE |
| RA | 1,337,394 | A→G | S522G (AGC→GGC) | acnA → | aconitate hydratase 1 |
| RA | 1,357,202 | C→T | intergenic (‑92/+221) | sapA ← / ← ymjA | putative periplasmic binding protein SapA/DUF2543 domain‑containing protein YmjA |
| RA | 1,358,859 | T→C | Y110C (TAT→TGT) | puuP ← | putrescine:H(+) symporter PuuP |
| MC JC | 1,367,750 | Δ176 bp | [pspF] | [pspF] | |
| JC JC | 1,399,590 | IS5 (+) +4 bp | intergenic (‑64/+128) | fnr ← / ← ogt | DNA‑binding transcriptional dual regulator FNR/methylated‑DNA‑‑[protein]‑cysteine S‑methyltransferase |
| RA | 1,401,893 | G→A | Q455* (CAA→TAA) | abgB ← | p‑aminobenzoyl‑glutamate hydrolase subunit B |
| RA | 1,423,338 | G→C | intergenic (+26/‑62) | ydaW → / → rzoR | putative uncharacterized protein YdaW/putative prophage outer membrane lipoprotein RzoR |
| RA | 1,423,404 | G→T | R2L (CGA→CTA) | rzoR → | putative prophage outer membrane lipoprotein RzoR |
| RA | 1,428,945 | C→T | pseudogene (150/189 nt) | lomR → | Rac prophage; protein LomR_1 |
| RA | 1,428,954 | T→A | pseudogene (159/189 nt) | lomR → | Rac prophage; protein LomR_1 |
| RA | 1,428,963 | G→T | pseudogene (168/189 nt) | lomR → | Rac prophage; protein LomR_1 |
| RA | 1,428,966 | T→G | pseudogene (171/189 nt) | lomR → | Rac prophage; protein LomR_1 |
| RA | 1,428,978 | G→A | pseudogene (183/189 nt) | lomR → | Rac prophage; protein LomR_1 |
| RA | 1,429,021 | 2 bp→AA | intergenic (+37/‑27) | lomR → / → stfR | Rac prophage; protein LomR_1/putative prophage side tail fiber protein StfR |
| RA | 1,429,024 | A→C | intergenic (+40/‑25) | lomR → / → stfR | Rac prophage; protein LomR_1/putative prophage side tail fiber protein StfR |
| RA | 1,429,027 | C→T | intergenic (+43/‑22) | lomR → / → stfR | Rac prophage; protein LomR_1/putative prophage side tail fiber protein StfR |
| RA | 1,429,069 | T→A | G7G (GGT→GGA) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,072 | A→C | V8V (GTA→GTC) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,111 | A→C | T21T (ACA→ACC) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,114 | C→T | I22I (ATC→ATT) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,126 | A→C | A26A (GCA→GCC) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,128 | A→G | K27R (AAA→AGA) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,160 | C→G | L38V (CTG→GTG) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,164 | C→G | A39G (GCC→GGC) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,171 | A→G | E41E (GAA→GAG) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,204 | C→T | D52D (GAC→GAT) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,207 | T→G | V53V (GTT→GTG) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,225 | C→T | S59S (AGC→AGT) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,228 | T→C | V60V (GTT→GTC) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,231 | T→C | I61I (ATT→ATC) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,235 | 2 bp→CA | coding (187‑188/3363 nt) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,240 | G→T | V64V (GTG→GTT) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,243 | A→C | E65D (GAA→GAC) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,246 | A→T | G66G (GGA→GGT) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,249 | C→T | F67F (TTC→TTT) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,252 | G→A | P68P (CCG→CCA) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,255 | G→A | P69P (CCG→CCA) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,258 | A→G | S70S (TCA→TCG) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,261 | T→C | H71H (CAT→CAC) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,273 | T→C | I75I (ATT→ATC) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,291 | T→A | S81S (TCT→TCA) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,297 | C→G | P83P (CCC→CCG) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,300 | T→G | G84G (GGT→GGG) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,319 | G→T | G91C (GGT→TGT) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,345 | T→G | R99R (CGT→CGG) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,353 | 2 bp→TG | coding (305‑306/3363 nt) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,360 | C→T | R104R (CGC→CGT) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,364 | T→C | F106L (TTT→CTT) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,404 | C→T | A119V (GCG→GTG) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,416 | 2 bp→GT | coding (368‑369/3363 nt) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,425 | C→A | A126D (GCC→GAC) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,435 | G→A | K129K (AAG→AAA) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,442 | A→G | S132G (AGT→GGC) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,444 | T→C | S132G (AGT→GGC) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,453 | 2 bp→TG | coding (405‑406/3363 nt) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,462 | 3 bp→TGC | coding (414‑416/3363 nt) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,466 | G→C | E140Q (GAG→CAG) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,470 | 2 bp→TC | coding (422‑423/3363 nt) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,474 | 2 bp→GG | coding (426‑427/3363 nt) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,479 | A→T | H144L (CAT→CTT) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,482 | C→T | A145V (GCG→GTG) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,484 | G→A | A146T (GCT→ACT) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,492 | 2 bp→AA | coding (444‑445/3363 nt) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,495 | G→T | A149A (GCG→GCT) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,510 | A→C | A154A (GCA→GCC) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,522 | A→C | S158S (TCA→TCC) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,534 | C→T | A162A (GCC→GCT) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,537 | G→A | A163A (GCG→GCA) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,543 | G→A | S165S (TCG→TCA) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,550 | 2 bp→GA | coding (502‑503/3363 nt) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,558 | T→C | S170S (TCT→TCC) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,562 | A→G | S172G (AGC→GGC) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,569 | G→A | G174E (GGA→GAA) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,571 | A→G | T175A (ACG→GCG) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,580 | A→G | T178A (ACA→GCA) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,597 | 3 bp→GGA | coding (549‑551/3363 nt) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,609 | T→C | A187A (GCT→GCC) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,612 | C→A | A188A (GCC→GCA) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,615 | T→C | A189A (GCT→GCC) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,632 | G→A | S195N (AGC→AAC) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,682 | T→G | S212A (TCA→GCA) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,692 | T→A | L215Q (CTA→CAA) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,702 | A→C | A218A (GCA→GCC) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,708 | A→G | T220T (ACA→ACG) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,714 | A→C | A222A (GCA→GCC) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,724 | A→G | T226A (ACC→GCC) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,732 | G→A | K228K (AAG→AAA) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,735 | A→G | A229A (GCA→GCG) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,741 | A→G | E231E (GAA→GAG) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,744 | T→C | A232A (GCT→GCC) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,747 | G→C | A233A (GCG→GCC) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,750 | C→T | T234T (ACC→ACT) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,753 | G→A | S235S (TCG→TCA) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,756 | C→A | A236A (GCC→GCA) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,759 | G→A | R237R (CGG→CGA) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,767 | C→T | A240V (GCG→GTG) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,780 | A→G | E244E (GAA→GAG) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,783 | G→A | A245A (GCG→GCA) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,816 | C→T | S256S (AGC→AGT) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,820 | A→G | S258G (AGT→GGT) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,823 | A→C | S259R (AGT→CGT) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,851 | G→A | G268E (GGA→GAA) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,858 | C→T | S270S (TCC→TCT) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,861 | G→C | A271A (GCG→GCC) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,863 | A→G | K272R (AAG→AGG) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,888 | C→T | N280N (AAC→AAT) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,429,897 | T→A | S283S (TCT→TCA) | stfR → | putative prophage side tail fiber protein StfR |
| RA | 1,453,992 | G→A | W22* (TGG→TGA) | paaA → | phenylacetyl‑CoA 1,2‑epoxidase, monooxygenase subunit |
| RA | 1,597,364 | T→C | intergenic (‑4922/+1253) | hipB ← / ← lsrK | antitoxin/DNA‑binding transcriptional repressor HipB/autoinducer‑2 kinase |
| RA | 1,643,679 | A→T | L209Q (CTG→CAG) | ydfU ← | protein YdfU |
| RA | 1,652,331 | T→C | intergenic (+2346/+397) | ydfD → / ← ynfP | lysis protein/protein YnfP |
| RA | 1,670,507 | G→A | W270* (TGG→TAG) | ynfM → | putative transporter YnfM |
| JC | 1,679,563 | (TATCACGTTTTAATCACTGGATATCGATGGAAA)1→2 | coding (7/1383 nt) | ydgI → | putative arginine:ornithine antiporter |
| RA | 1,721,136 | C→T | L38F (CTT→TTT) | ydhI → | DUF1656 domain‑containing protein YdhI |
| RA | 1,776,100 | G→A | E172K (GAA→AAA) | ydiF → | putative acetate‑CoA transferase YdiF |
| RA | 1,776,715 | A→T | S377C (AGT→TGT) | ydiF → | putative acetate‑CoA transferase YdiF |
| RA | 1,894,839 | T→C | L12P (CTC→CCC) | pabB → | aminodeoxychorismate synthase subunit 1 |
| RA | 1,955,010 | G→A | D666D (GAC→GAT) | torZ ← | trimethylamine N‑oxide reductase 2 |
| MC JC | 1,978,503 | Δ776 bp | insB5–insA5 | insB5, insA5 | |
| RA | 1,994,637 | A→G | Y24H (TAC→CAC) | uvrC ← | UvrABC excision nuclease subunit C |
| RA | 2,040,433 | C→A | A319D (GCC→GAC) | msrP → | protein‑L‑methionine sulfoxide reductase catalytic subunit MsrP |
| RA | 2,041,411 | G→A | G13S (GGT→AGT) | zinT → | metal‑binding protein ZinT |
| RA | 2,046,506 | G→T | V523V (GTG→GTT) | yeeJ → | inverse autotransporter adhesin |
| RA | 2,085,319 | G→A | A69A (GCC→GCT) | tsuA ← | thiosulfate transporter |
| RA | 2,086,634 | G→A | A143A (GCC→GCT) | plaP ← | putrescine:H(+) symporter PlaP |
| RA | 2,103,891 | G→A | P207S (CCA→TCA) | wbbK ← | putative glycosyltransferase WbbK |
| RA | 2,111,259 | Δ1 bp | coding (718/900 nt) | rfbD ← | dTDP‑4‑dehydrorhamnose reductase |
| RA | 2,122,908 | G→A | I24I (ATC→ATT) | cpsG ← | phosphomannomutase |
| RA | 2,134,498 | G→A | V385V (GTC→GTT) | wzc ← | protein‑tyrosine kinase Wzc |
| RA | 2,137,543 | G→A | intergenic (‑300/‑359) | wza ← / → yegH | outer membrane polysaccharide export protein Wza/inner membrane protein YegH |
| RA | 2,173,363 | Δ2 bp | intergenic (‑490/+918) | gatD ← / ← gatB | galactitol‑1‑phosphate 5‑dehydrogenase/galactitol‑specific PTS enzyme IIB component |
| RA | 2,173,448 | C→T | intergenic (‑575/+834) | gatD ← / ← gatB | galactitol‑1‑phosphate 5‑dehydrogenase/galactitol‑specific PTS enzyme IIB component |
| JC JC | 2,174,359 | IS5 (+) +4 bp | coding (205‑208/285 nt) | gatB ← | galactitol‑specific PTS enzyme IIB component |
| RA | 2,188,087 | T→C | T110A (ACG→GCG) | yehA ← | putative fimbrial adhesin YehA |
| RA | 2,329,209 | A→G | W197R (TGG→CGG) | yfaQ ← | tandem DUF2300 domain‑containing protein YfaQ |
| RA | 2,339,162 | C→T | D87N (GAC→AAC) | gyrA ← | DNA gyrase subunit A |
| JC JC | 2,378,926 | IS5 (–) +4 bp | coding (331‑334/1671 nt) | menD ← | 2‑succinyl‑5‑enolpyruvyl‑6‑hydroxy‑3‑ cyclohexene‑1‑carboxylate synthase |
| RA | 2,384,808 | C→T | K305K (AAG→AAA) | yfbK ← | IPR002035/DUF3520 domain‑containing protein YfbK |
| RA | 2,410,419 | G→A | L312L (CTG→TTG) | yfbS ← | putative transporter YfbS |
| RA | 2,484,827 | C→T | L152F (CTT→TTT) | evgS → | sensor histidine kinase EvgS |
| RA | 2,510,609 | C→T | P327L (CCG→CTG) | yfeO → | putative transport protein YfeO |
| RA | 2,518,092 | G→T | noncoding (25/76 nt) | alaX ← | tRNA‑Ala |
| MC JC | 2,558,699 | Δ6,790 bp | intZ–[eutA] | intZ, yffL, yffM, yffN, yffO, yffP, yffQ, yffR, yffS, [eutA] | |
| RA | 2,587,112 | C→T | A461V (GCA→GTA) | narQ → | sensor histidine kinase NarQ |
| RA | 2,732,992 | G→A | I394I (ATC→ATT) I394I (ATC→ATT) |
clpB ← clpB ← |
chaperone protein ClpB chaperone protein ClpB |
| RA | 2,823,537 | A→G | L78P (CTG→CCG) | recA ← | DNA recombination/repair protein RecA |
| RA | 2,856,243 | A→G | T636A (ACG→GCG) | fhlA → | DNA‑binding transcriptional activator FhlA |
| RA | 2,867,454 | T→A | Q33L (CAG→CTG) | rpoS ← | RNA polymerase sigma factor RpoS |
| RA | 2,871,153 | T→G | N51T (AAC→ACC) | truD ← | tRNA pseudouridine(13) synthase |
| RA | 2,926,543 | 2 bp→TT | coding (236‑237/1365 nt) | ppnN → | nucleotide 5'‑monophosphate nucleosidase |
| RA | 2,926,772 | C→A | G155G (GGC→GGA) | ppnN → | nucleotide 5'‑monophosphate nucleosidase |
| JC JC | 2,993,231 | IS5 (–) +4 bp | coding (1138‑1141/1377 nt) | ygeH → | putative transcriptional regulator YgeH |
| RA | 3,028,546 | G→A | A156V (GCC→GTC) | ygfS ← | putative electron transport protein YgfS |
| RA | 3,050,472 | G→A | L66L (CTG→TTG) | gcvT ← | aminomethyltransferase |
| RA | 3,061,916 | C→T | A356V (GCC→GTC) | scpA → | methylmalonyl‑CoA mutase |
| RA | 3,065,449 | G→A | L216L (TTG→TTA) | scpC → | propionyl‑CoA:succinate CoA transferase |
| RA | 3,065,861 | G→A | V354I (GTC→ATC) | scpC → | propionyl‑CoA:succinate CoA transferase |
| RA | 3,089,260 | T→C | V326A (GTG→GCG) | galP → | galactose:H(+) symporter |
| RA | 3,090,968 | G→A | E208K (GAG→AAG) | endA → | DNA‑specific endonuclease I |
| RA | 3,104,887 | G→A | S152N (AGC→AAC) | mltC → | membrane‑bound lytic murein transglycosylase C |
| RA | 3,120,786 | G→A | T165I (ACT→ATT) | glcA ← | glycolate/lactate:H(+) symporter GlcA |
| RA | 3,121,033 | T→C | I83V (ATT→GTT) | glcA ← | glycolate/lactate:H(+) symporter GlcA |
| RA | 3,127,981 | G→A | P14L (CCC→CTC) | glcD ← | glycolate dehydrogenase, putative FAD‑linked subunit |
| RA | 3,130,161 | G→A | L19F (CTT→TTT) | yghO ← | putative DNA‑binding transcriptional regulator YghO |
| RA | 3,132,077 | G→A | A111V (GCG→GTG) | yghQ ← | putative transport protein YghQ |
| RA | 3,133,175 | G→A | T13I (ACC→ATC) | yghR ← | putative ATP‑binding protein YghR |
| RA | 3,134,263 | G→A | A45T (GCC→ACC) | yghT → | putative ATP‑binding protein YghT |
| RA | 3,145,944 | G→A | L106L (CTC→CTT) | hybO ← | hydrogenase 2 small subunit |
| RA | 3,150,316 | G→A | E219K (GAG→AAG) | yghA → | NADP(+)‑dependent aldehyde reductase |
| RA | 3,162,216 | G→A | Q152* (CAG→TAG) | ftsP ← | cell division protein FtsP |
| RA | 3,176,625 | G→A | S70F (TCC→TTC) | cpdA ← | cAMP phosphodiesterase |
| RA | 3,179,383 | G→A | K423K (AAG→AAA) | tolC → | outer membrane channel TolC |
| RA | 3,186,297 | G→A | R37R (CGG→CGA) | insC5 → | IS2 insertion element repressor InsA |
| RA | 3,193,351 | G→A | G163E (GGG→GAG) | yqiK → | flotillin family inner membrane protein YqiK |
| RA | 3,204,617 | G→A | intergenic (‑28/‑77) | folB ← / → plsY | dihydroneopterin aldolase/putative glycerol‑3‑phosphate acyltransferase |
| RA | 3,207,549 | Δ1 bp | coding (179/606 nt) | ttdB → | L(+)‑tartrate dehydratase subunit beta |
| RA | 3,219,128 | G→A | intergenic (‑52/‑366) | aer ← / → patA | aerotaxis receptor/putrescine aminotransferase |
| RA | 3,224,895 | C→T | L755L (CTG→TTG) | ebgA → | evolved beta‑D‑galactosidase subunit alpha |
| RA | 3,227,339 | C→T | T369I (ACC→ATC) | ygjI → | putative transporter YgjI |
| RA | 3,240,423 | C→T | G160G (GGC→GGT) | sstT → | serine/threonine:Na(+) symporter |
| RA | 3,256,157 | C→T | Q165Q (CAG→CAA) | cyuA ← | putative L‑cysteine desulfidase CyuA |
| RA | 3,259,283 | G→A | H123Y (CAT→TAT) | tdcG ← | L‑serine deaminase III |
| RA | 3,270,497 | C→T | noncoding (96/377 nt) | rnpB ← | RNase P catalytic RNA component |
| RA | 3,275,902 | A→T | E207D (GAA→GAT) | garD → | GarD |
| RA | 3,292,312 | C→T | P324P (CCC→CCT) | yraK → | putative fimbrial adhesin YraK |
| RA | 3,304,647 | T→C | I391V (ATT→GTT) | mtr ← | tryptophan:H(+) symporter Mtr |
| RA | 3,329,743 | G→T | D261Y (GAT→TAT) | dacB → | peptidoglycan DD‑endopeptidase DacB |
| JC JC | 3,368,685 | IS2 (–) +5 bp | coding (859‑863/1128 nt) | yhcG → | DUF1016 domain‑containing protein YhcG |
| RA | 3,377,240 | T→G | T61P (ACC→CCC) | sspA ← | stringent starvation protein A |
| RA | 3,388,041 | T→G | T50P (ACG→CCG) | aaeB ← | aromatic carboxylic acid efflux pump subunit AaeB |
| RA | 3,506,393 | T→C | D315G (GAC→GGC) | yhfT ← | uncharacterized protein YhfT |
| RA | 3,524,184 | C→T | A438A (GCC→GCT) | mrcA → | peptidoglycan glycosyltransferase/peptidoglycan DD‑transpeptidase MrcA |
| RA | 3,558,291 | C→T | G8G (GGC→GGT) | rtcR → | DNA‑binding transcriptional activator RtcR |
| RA | 3,559,621 | C→T | P452S (CCC→TCC) | rtcR → | DNA‑binding transcriptional activator RtcR |
| RA | 3,560,119 | A→G | intergenic (+253/+503) | rtcR → / ← glpG | DNA‑binding transcriptional activator RtcR/rhomboid protease GlpG |
| RA | 3,560,455 | +G | intergenic (+589/+167) | rtcR → / ← glpG | DNA‑binding transcriptional activator RtcR/rhomboid protease GlpG |
| RA | 3,579,050 | G→A | A199V (GCC→GTC) | yhhW ← | quercetin 2,3‑dioxygenase |
| RA | 3,581,316 | G→A | G60E (GGA→GAA) | yhhY → | N‑acetyltransferase YhhY |
| RA | 3,581,850 | G→A | intergenic (+224/‑13) | yhhY → / → yhhZ | N‑acetyltransferase YhhY/putative endonuclease YhhZ |
| RA | 3,583,969 | G→A | W98* (TGG→TAG) | insB6 → | IS1 family protein InsB |
| RA | 3,585,517 | G→A | A436V (GCC→GTC) | ggt ← | glutathione hydrolase proenzyme |
| RA | 3,587,531 | G→A | L195F (CTC→TTC) | ugpQ ← | glycerophosphodiester phosphodiesterase UgpQ |
| RA | 3,588,787 | G→A | P132S (CCG→TCG) | ugpC ← | sn‑glycerol 3‑phosphate ABC transporter ATP binding subunit |
| RA | 3,589,956 | G→A | L24L (CTC→CTT) | ugpE ← | sn‑glycerol 3‑phosphate ABC transporter membrane subunit UgpE |
| RA | 3,621,090 | C→T | R633R (CGC→CGT) | rhsB → | rhs element protein RhsB |
| RA | 3,647,677 | C→T | intergenic (+26/+28) | gor → / ← dinQ | glutathione reductase (NADPH)/membrane toxin DinQ |
| RA | 3,707,947 | C→A | intergenic (‑242/+669) | dppA ← / ← proK | dipeptide ABC transporter periplasmic binding protein/tRNA‑Pro |
| RA | 3,725,176 | T→G | E48A (GAG→GCG) | glyQ ← | glycine‑‑tRNA ligase subunit alpha |
| RA | 3,815,883 | +C | coding (667/687 nt) | rph ← | truncated RNase PH |
| RA | 3,827,026 | C→T | A606V (GCG→GTG) | recG → | ATP‑dependent DNA helicase RecG |
| RA | 3,927,292 | T→C | D46D (GAT→GAC) | asnA → | asparagine synthetase A |
| RA | 3,937,909 | G→A | A206T (GCG→ACG) | rbsK → | ribokinase |
| RA | 3,937,997 | G→A | G235D (GGT→GAT) | rbsK → | ribokinase |
| RA | 3,938,441 | Δ1 bp | coding (215/993 nt) | rbsR → | DNA‑binding transcriptional dual regulator RbsR |
| RA | 3,941,874 | C→T | noncoding (67/1542 nt) | rrsC → | 16S ribosomal RNA |
| RA | 3,946,246 | G→A | noncoding (2543/2904 nt) | rrlC → | 23S ribosomal RNA |
| RA | 3,950,099 | C→T | intergenic (‑130/‑223) | yifB ← / → ilvL | putative magnesium chelatase YifB/ilvXGMEDA operon leader peptide |
| RA | 3,956,003 | G→A | D225N (GAT→AAT) | ilvA → | threonine deaminase |
| RA | 4,084,932 | G→T | F297L (TTC→TTA) | fdoG ← | formate dehydrogenase O subunit alpha |
| RA | 4,139,298 | G→A | A137A (GCC→GCT) | fsaB ← | fructose‑6‑phosphate aldolase 2 |
| RA | 4,160,157 | G→A | L212L (CTG→TTG) | sthA ← | soluble pyridine nucleotide transhydrogenase |
| RA | 4,175,827 | C→T | noncoding (74/76 nt) | thrT → | tRNA‑Thr |
| RA | 4,178,883 | C→T | A2V (GCT→GTT) | rplA → | 50S ribosomal subunit protein L1 |
| RA | 4,179,001 | C→T | S41S (AGC→AGT) | rplA → | 50S ribosomal subunit protein L1 |
| RA | 4,185,777 | C→T | S143F (TCC→TTC) | rpoC → | RNA polymerase subunit beta' |
| RA | 4,193,177 | C→T | E134K (GAG→AAG) | thiF ← | sulfur carrier protein ThiS adenylyltransferase |
| RA | 4,193,820 | C→T | G129R (GGA→AGA) | thiE ← | thiamine phosphate synthase |
| RA | 4,219,752 | C→T | S386F (TCC→TTC) | aceK → | isocitrate dehydrogenase kinase/phosphatase |
| RA | 4,222,743 | C→T | intergenic (‑256/+61) | arpA ← / ← iclR | regulator of acetyl CoA synthetase/DNA‑binding transcriptional repressor IclR |
| RA | 4,223,638 | T→C | intergenic (‑10/‑190) | iclR ← / → metH | DNA‑binding transcriptional repressor IclR/cobalamin‑dependent methionine synthase |
| RA | 4,224,483 | C→T | S219F (TCC→TTC) | metH → | cobalamin‑dependent methionine synthase |
| RA | 4,234,479 | C→T | A241V (GCG→GTG) | pgi → | glucose‑6‑phosphate isomerase |
| RA | 4,249,684 | C→T | A44V (GCT→GTT) | malM → | maltose regulon periplasmic protein |
| RA | 4,265,668 | C→T | T452I (ACC→ATC) | dnaB → | replicative DNA helicase |
| RA | 4,269,449 | C→T | C12C (TGC→TGT) | aphA → | acid phosphatase/phosphotransferase |
| RA | 4,271,130 | C→T | E914E (GAG→GAA) | uvrA ← | UvrABC excision nuclease subunit A |
| RA | 4,278,488 | C→T | P4S (CCA→TCA) | ghxP → | guanine/hypoxanthine transporter GhxP |
| RA | 4,282,536 | C→T | Q180Q (CAG→CAA) | yjcF ← | pentapeptide repeat‑containing protein YjcF |
| RA | 4,284,077 | C→T | A276T (GCG→ACG) | actP ← | acetate/glycolate:cation symporter |
| RA | 4,286,033 | C→T | A447T (GCG→ACG) | acs ← | acetyl‑CoA synthetase (AMP‑forming) |
| RA | 4,296,187 | C→T | intergenic (+393/+249) | gltP → / ← yjcO | glutamate/aspartate : H(+) symporter GltP/Sel1 repeat‑containing protein YjcO |
| RA | 4,296,300 | C→T | intergenic (+506/+136) | gltP → / ← yjcO | glutamate/aspartate : H(+) symporter GltP/Sel1 repeat‑containing protein YjcO |
| RA | 4,296,381 | +GC | intergenic (+587/+55) | gltP → / ← yjcO | glutamate/aspartate : H(+) symporter GltP/Sel1 repeat‑containing protein YjcO |
| RA | 4,297,469 | C→T | G633D (GGC→GAC) | fdhF ← | formate dehydrogenase H |
| RA | 4,298,199 | C→T | A390T (GCA→ACA) | fdhF ← | formate dehydrogenase H |
| RA | 4,301,071 | C→T | A670T (GCA→ACA) | mdtO ← | putative multidrug efflux pump subunit MdtO |
| RA | 4,303,755 | C→T | V119I (GTT→ATT) | mdtN ← | putative multidrug efflux pump membrane fusion protein |
| RA | 4,311,337 | C→T | A236T (GCA→ACA) | alsB ← | D‑allose ABC transporter periplasmic binding protein |
| RA | 4,320,079 | C→T | Q195Q (CAG→CAA) | phnI ← | carbon‑phosphorus lyase core complex subunit PhnI |
| RA | 4,320,785 | C→T | E155K (GAG→AAG) | phnH ← | carbon‑phosphorus lyase core complex subunit PhnH |
| RA | 4,322,605 | C→T | intergenic (‑183/+731) | phnF ← / ← phnD | putative transcriptional regulator PhnF/phosphonate/phosphate ABC transporter periplasmic binding protein |
| RA | 4,325,644 | C→T | S33N (AGC→AAC) | yjdN ← | PF06983 family protein YjdN |
| RA | 4,325,837 | C→T | intergenic (‑96/+562) | yjdN ← / ← yjdM | PF06983 family protein YjdN/zinc ribbon domain‑containing protein YjdM |
| RA | 4,332,310 | C→T | G321G (GGG→GGA) | basS ← | sensor histidine kinase BasS |
| RA | 4,337,864 | C→T | V22V (GTG→GTA) | adiY ← | DNA‑binding transcriptional activator AdiY |
| RA | 4,342,825 | C→T | N305N (AAC→AAT) | melA → | alpha‑galactosidase |
| RA | 4,349,259 | C→T | intergenic (‑515/+56) | dcuB ← / ← dcuR | anaerobic C4‑dicarboxylate transporter DcuB/DNA‑binding transcriptional activator DcuR |
| RA | 4,351,519 | C→T | T48T (ACG→ACA) | dcuS ← | sensor histidine kinase DcuS |
| RA | 4,351,590 | C→T | V25I (GTC→ATC) | dcuS ← | sensor histidine kinase DcuS |
| RA | 4,359,909 | C→T | W41* (TGG→TGA) | cadB ← | lysine:cadaverine antiporter |
| RA | 4,364,798 | C→T | G82D (GGC→GAC) | dsbD ← | thiol‑disulfide exchange protein DsbD |
| RA | 4,366,668 | C→T | A36T (GCC→ACC) | dcuA ← | C4‑dicarboxylate transporter DcuA |
| RA | 4,371,401 | C→T | A126V (GCT→GTT) | groL → | chaperonin GroEL |
| RA | 4,373,421 | C→T | A272T (GCG→ACG) | yjeJ ← | protein YjeJ |
| RA | 4,380,469 | C→T | E17K (GAA→AAA) | frdB ← | fumarate reductase iron‑sulfur protein |
| RA | 4,388,120 | C→T | A417A (GCG→GCA) | mscM ← | miniconductance mechanosensitive channel MscM |
| RA | 4,389,838 | C→T | V175M (GTG→ATG) | psd ← | phosphatidylserine decarboxylase proenzyme |
| RA | 4,401,607 | C→T | T312T (ACC→ACT) | hflX → | ribosome rescue factor HflX |
| RA | 4,403,010 | C→T | R325C (CGT→TGT) | hflK → | regulator of FtsH protease |
| RA | 4,407,045 | C→T | A131V (GCT→GTT) | rnr → | RNase R |
| RA | 4,414,625 | C→T | R117R (CGC→CGT) | aidB → | putative acyl‑CoA dehydrogenase AidB |
| RA | 4,418,862 | C→T | G255D (GGT→GAT) | ulaG ← | L‑ascorbate‑6‑phosphate lactonase |
| RA | 4,426,929 | C→T | C165Y (TGC→TAC) | yjfZ ← | DUF2686 domain‑containing protein YjfZ |
| RA | 4,433,459 | C→T | G189D (GGC→GAC) | qorB ← | NAD(P)H:quinone oxidoreductase |
| JC JC | 4,434,629 | IS1 (–) +8 bp | coding (1930‑1937/1944 nt) | cpdB ← | 2',3'‑cyclic‑nucleotide 2'‑phosphodiesterase/3'‑nucleotidase |
| RA | 4,435,124 | C→T | W481* (TGG→TAG) | cpdB ← | 2',3'‑cyclic‑nucleotide 2'‑phosphodiesterase/3'‑nucleotidase |
| RA | 4,435,750 | C→T | G272G (GGG→GGA) | cpdB ← | 2',3'‑cyclic‑nucleotide 2'‑phosphodiesterase/3'‑nucleotidase |
| RA | 4,451,280 | C→T | P75S (CCG→TCG) | ytfR → | galactofuranose ABC transporter putative ATP binding subunit |
| RA | 4,457,392 | C→T | E158E (GAG→GAA) | yjgA ← | putative ribosome biogenesis factor YjgA |
| RA | 4,482,901 | C→T | V313M (GTG→ATG) | valS ← | valine‑‑tRNA ligase |
| RA | 4,486,869 | T→A | L218M (TTG→ATG) | lptF → | lipopolysaccharide transport system protein LptF |
| RA | 4,487,022 | C→T | R269C (CGT→TGT) | lptF → | lipopolysaccharide transport system protein LptF |
| RA | 4,489,775 | C→T | V97M (GTG→ATG) | yjgR ← | DUF853 domain‑containing protein YjgR |
| RA | 4,494,499 | C→T | intergenic (‑93/‑124) | idnD ← / → idnK | L‑idonate 5‑dehydrogenase/D‑gluconate kinase, thermosensitive |
| RA | 4,501,500 | C→T | L81L (CTG→TTG) | yjgZ → | uncharacterized protein YjgZ |
| RA | 4,510,238 | T→G | intergenic (+445/+452) | insO → / ← fecE | IS911B regulator fragment/ferric citrate ABC transporter ATP binding subunit |
| RA | 4,517,355 | C→T | Q121Q (CAG→CAA) | fecR ← | ferric citrate regulator FecR |
| RA | 4,524,401 | C→T | G204S (GGC→AGC) | yjhH ← | putative 2‑dehydro‑3‑deoxy‑D‑pentonate aldolase |
| RA | 4,524,596 | C→T | D139N (GAT→AAT) | yjhH ← | putative 2‑dehydro‑3‑deoxy‑D‑pentonate aldolase |
| RA | 4,529,039 | C→T | G402D (GGT→GAT) | sgcC ← | putative PTS enzyme IIC component SgcC |
| RA | 4,530,797 | C→T | Q285Q (CAG→CAA) | sgcX ← | putative endoglucanase with Zn‑dependent exopeptidase domain |
| RA | 4,541,261 | C→T | A102V (GCT→GTT) | fimB → | Type 1 fimbriae regulatory protein FimB |
| JC JC | 4,542,042 | IS1 (+) +8 bp | coding (6‑13/597 nt) | fimE → | regulator for fimA |
| RA | 4,553,671 | C→T | F257F (TTC→TTT) | uxuB → | D‑mannonate oxidoreductase |
| RA | 4,564,385 | C→T | S102N (AGC→AAC) | yjiL ← | putative ATPase, activator of (R)‑hydroxyglutaryl‑CoA dehdratase |
| RA | 4,570,550 | C→T | S342N (AGC→AAC) | yjiR ← | fused putative DNA‑binding transcriptional regulator/putative aminotransferase YjiR |
| RA | 4,571,280 | C→T | E99K (GAG→AAG) | yjiR ← | fused putative DNA‑binding transcriptional regulator/putative aminotransferase YjiR |
| RA | 4,585,673 | C→T | W363* (TGG→TGA) | hsdR ← | type I restriction enzyme EcoKI endonuclease subunit |
| RA | 4,587,365 | C→T | S139S (AGC→AGT) | mrr → | Type IV methyl‑directed restriction enzyme EcoKMrr |
| RA | 4,604,517 | C→T | L120L (CTG→TTG) | bglJ → | DNA‑binding transcriptional regulator BglJ |
| RA | 4,636,925 | G→C | R77P (CGC→CCC) | creC → | sensory histidine kinase CreC |
| RA | 4,638,240 | G→A | L21L (TTG→TTA) | creD → | putative inner membrane protein CreD |
| Unassigned missing coverage evidence | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| seq id | start | end | size | ←reads | reads→ | gene | description | |||
| * | * | ÷ | NC_000913 | 565829 | 566071 | 243 | 28 [0] | [0] 4 | [intD] | [intD] |
| * | * | ÷ | NC_000913 | 566378 | 566399 | 22 | 3 [0] | [2] 3 | intD/renD | putative integrase/protein RenD |
| * | * | ÷ | NC_000913 | 568132 | 577187 | 9056 | 3 [2] | [0] 28 | [renD]–nmpC | [renD],emrE,ylcJ,ybcK,ybcL,ybcM,ylcH,ybcN,ninE,ybcO,rusA,ylcG,quuD,nmpC,insH2,nmpC |
| * | * | ÷ | NC_000913 | 1196375 | 1211415 | 15041 | 3 [0] | [2] 4 | C0293–mcrA | C0293,ymfD,ymfE,lit,intE,xisE,ymfH,ymfI,ymfJ,ymfK,ymfT,ymfL,ymfM,ymfN,ymfR,beeE,ymfQ,ycfK,tfaP,tfaE,pinE,mcrA |
| * | * | ÷ | NC_000913 | 1411925 | 1423199 | 11275 | 17 [0] | [0] 4 | [ttcA]–[ydaW] | [ttcA],intR,xisR,rcbA,ralA,ralR,recT,recE,racC,ydaE,kilR,kilS,sieB,ydaF,ydaG,racR,ydaS,ydaT,ydaU,ydaV,[ydaW] |
| * | * | ÷ | NC_000913 | 1423549–1423569 | 1428908 | 5340–5360 | 3 [1] | [2] 3 | [rzoR]–[lomR] | [rzoR],trkG,ynaK,ydaY,ynaA,lomR,insH5,[lomR] |
| * | * | ÷ | NC_000913 | 1429927 | 1434968 | 5042 | 3 [2] | [2] 3 | [stfR]–ynaM | [stfR],tfaR,pinR,ynaE,ynaM |
| * | * | ÷ | NC_000913 | 3423881–3424234 | 3424429–3424238 | 5–549 | 3 [2] | [2] 3 | rrlD | 23S ribosomal RNA |
| Unassigned new junction evidence | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
| * | ? | NC_000913 | = 249545 | 47 (1.240) | 33 (0.890) | 32/474 | 0.2 | 38.5% | intergenic (+1411/‑1353) | rayT/dinB | REP‑associated tyrosine transposase/DNA polymerase IV |
| ? | NC_000913 | 373870 = | 60 (1.630) | coding (950/951 nt) coding (3/1014 nt) |
mhpF mhpE |
acetaldehyde dehydrogenase (acetylating) MhpF 4‑hydroxy‑2‑oxovalerate aldolase |
|||||
| * | ? | NC_000913 | 273955 = | NA (NA) | 28 (0.740) | 28/488 | 0.4 | 100% | noncoding (1195/1195 nt) | IS5 | repeat region |
| ? | NC_000913 | = 565828 | 0 (0.000) | coding (151/1164 nt) | intD | putative integrase | |||||
| * | ? | NC_000913 | = 275149 | NA (NA) | 28 (0.740) | 23/488 | 0.5 | 100% | noncoding (1/1195 nt) | IS5 | repeat region |
| ? | NC_000913 | 577188 = | 0 (0.000) | intergenic (‑363/‑210) | nmpC/essD | putative outer membrane porin NmpC/putative phage lysis protein | |||||
| * | ? | NC_000913 | = 366180 | 44 (1.160) | 47 (1.240) | 44/488 | 0.1 | 55.0% | coding (126/3075 nt) | lacZ | beta‑galactosidase |
| ? | NC_000913 | 366274 = | 33 (0.870) | coding (32/3075 nt) | lacZ | beta‑galactosidase | |||||
| * | ? | NC_000913 | = 566774 | 0 (0.000) | 12 (0.320) | 9/484 | 1.7 | 100% | pseudogene (91/93 nt) | renD | protein RenD |
| ? | NC_000913 | 568036 = | 0 (0.000) | pseudogene (2/213 nt) | renD | protein RenD | |||||
| * | ? | NC_000913 | = 1411924 | 0 (0.000) | 17 (0.500) | 17/436 | 0.7 | 100% | coding (25/936 nt) | ttcA | tRNA cytosine(32) 2‑sulfurtransferase TtcA |
| ? | NC_000913 | 1434985 = | 0 (0.000) | intergenic (‑579/+200) | ynaM/uspF | protein YnaM/universal stress protein F | |||||