![]() |
breseq version 0.39.0
mutation predictions | marginal predictions | summary statistics | genome diff | command line log |
| Predicted mutations | |||||
|---|---|---|---|---|---|
| evidence | position | mutation | annotation | gene | description |
| JC JC | 16,974 | IS150 (–) +3 bp | noncoding (23‑25/59 nt) | sokC → | small regulatory RNA antitoxin SokC |
| RA | 23,501 | C→T | L371L (CTG→TTG) | ileS → | isoleucine‑‑tRNA ligase |
| RA | 31,683 | C→T | N289N (AAC→AAT) | carB → | carbamoyl‑phosphate synthetase large subunit |
| RA | 42,108 | G→A | intergenic (‑177/‑295) | caiT ← / → fixA | L‑carnitine:gamma‑butyrobetaine antiporter/putative electron transfer flavoprotein FixA |
| RA | 59,968 | C→T | V127I (GTC→ATC) | rluA ← | 23S rRNA pseudouridine(746) and tRNA pseudouridine(32) synthase |
| RA | 88,571 | G→A | V182M (GTG→ATG) | cra → | DNA‑binding transcriptional dual regulator Cra |
| RA | 246,747 | G→T | S12S (TCG→TCT) | yafL → | NlpC/P60 family protein YafL |
| MC JC | 257,908 | Δ776 bp | insB9–[crl] | insB9, insA9, [crl] | |
| RA | 284,535 | T→G | A445A (GCT→GCG) | yagF → | D‑xylonate dehydratase |
| RA | 313,543 | G→A | intergenic (‑301/‑1748) | ykgR ← / → insE1 | putative membrane protein YkgR/IS3 element protein InsE |
| MC JC | 366,181 | Δ93 bp | coding (33‑125/3075 nt) | lacZ ← | beta‑galactosidase |
| RA | 367,573 | G→A | intergenic (‑63/+14) | lacI ← / ← mhpR | DNA‑binding transcriptional repressor LacI/DNA‑binding transcriptional activator MhpR |
| JC JC | 458,790 | IS186 (–) +6 bp :: Δ1 bp | intergenic (+90/‑93) | clpX → / → lon | ATP‑dependent Clp protease ATP‑binding subunit ClpX/Lon protease |
| RA | 466,148 | G→A | P389S (CCA→TCA) | ybaE ← | uncharacterized protein YbaE |
| RA | 469,271 | G→A | G134E (GGG→GAG) | mdlA → | ABC transporter family protein MdlA |
| RA | 480,295 | 2 bp→AA | coding (13‑14/219 nt) | hha ← | hemolysin expression‑modulating protein Hha |
| RA | 502,232 | G→A | T336I (ACC→ATC) | ybaL ← | putative transporter YbaL |
| JC JC | 607,765 | IS150 (+) +3 bp | noncoding (26‑28/60 nt) | sokE ← | small RNA SokE |
| RA | 662,269 | C→T | D4N (GAT→AAT) | lipB ← | lipoyl(octanoyl) transferase |
| RA | 696,470 | C→T | noncoding (35/75 nt) | glnX ← | tRNA‑Gln |
| RA | 784,677 | G→A | A49A (GCC→GCT) | zitB ← | Zn(2(+))/Cd(2(+))/Ni(2(+))/Cu(2(+)) exporter |
| RA | 968,837 | G→A | D158N (GAT→AAT) | lpxK → | tetraacyldisaccharide 4'‑kinase |
| RA | 1,040,126 | G→T | L277L (CTG→CTT) | appB → | cytochrome bd‑II subunit 2 |
| RA | 1,061,935 | G→A | S46N (AGC→AAC) | torD → | trimethylamine‑N‑oxide reductase‑specific chaperone |
| RA | 1,069,743 | C→T | A33T (GCA→ACA) | rutG ← | pyrimidine:H(+) symporter |
| RA | 1,088,081 | G→T | Q593K (CAA→AAA) | pgaB ← | poly‑beta‑1,6‑N‑acetyl‑D‑glucosamine N‑deacetylase and beta‑1,6 glycoside hydrolase |
| RA | 1,098,620 | T→A | V245V (GTT→GTA) | ghrA → | glyoxylate/hydroxypyruvate reductase A |
| RA | 1,111,727 | 2 bp→TT | coding (865‑866/2544 nt) | opgH → | osmoregulated periplasmic glucans biosynthesis protein H |
| RA | 1,156,913 | G→A | G46D (GGT→GAT) | ycfH → | putative metal‑dependent hydrolase YcfH |
| RA | 1,169,836 | A→G | L180P (CTG→CCG) | ldtC ← | L,D‑transpeptidase LdtC |
| RA | 1,189,980 | A→G | T156T (ACT→ACC) | phoP ← | DNA‑binding transcriptional dual regulator PhoP |
| RA | 1,196,220 | C→T | H366H (CAC→CAT) | icd → | isocitrate dehydrogenase |
| RA | 1,196,232 | C→T | T370T (ACC→ACT) | icd → | isocitrate dehydrogenase |
| RA | 1,196,245 | T→C | L375M (TTA→CTG) | icd → | isocitrate dehydrogenase |
| RA | 1,196,247 | A→G | L375M (TTA→CTG) | icd → | isocitrate dehydrogenase |
| RA | 1,196,277 | C→T | N385N (AAC→AAT) | icd → | isocitrate dehydrogenase |
| RA | 1,196,280 | G→C | A386A (GCG→GCC) | icd → | isocitrate dehydrogenase |
| RA | 1,196,283 | A→G | K387K (AAA→AAG) | icd → | isocitrate dehydrogenase |
| RA | 1,196,292 | C→T | T390T (ACC→ACT) | icd → | isocitrate dehydrogenase |
| RA | 1,196,304 | G→A | E394E (GAG→GAA) | icd → | isocitrate dehydrogenase |
| MC JC | 1,299,499 | Δ1,199 bp | insH21 | insH21 | |
| RA | 1,301,992 | A→T | N271Y (AAT→TAT) | oppA → | oligopeptide ABC transporter periplasmic binding protein |
| RA | 1,302,454 | Δ1 bp | coding (1273/1632 nt) | oppA → | oligopeptide ABC transporter periplasmic binding protein |
| RA | 1,306,736 | T→G | S325A (TCC→GCC) | oppF → | murein tripeptide ABC transporter/oligopeptide ABC transporter ATP binding subunit OppF |
| RA | 1,310,770 | A→G | H32H (CAT→CAC) | yciI ← | protein YciI |
| RA | 1,322,759 | G→A | A63V (GCT→GTT) | trpE ← | anthranilate synthase subunit TrpE |
| RA | 1,332,570 | G→A | G508D (GGC→GAC) | topA → | DNA topoisomerase 1 |
| RA | 1,337,394 | A→G | S522G (AGC→GGC) | acnA → | aconitate hydratase 1 |
| RA | 1,357,202 | C→T | intergenic (‑92/+221) | sapA ← / ← ymjA | putative periplasmic binding protein SapA/DUF2543 domain‑containing protein YmjA |
| RA | 1,358,859 | T→C | Y110C (TAT→TGT) | puuP ← | putrescine:H(+) symporter PuuP |
| MC JC | 1,367,750 | Δ176 bp | [pspF] | [pspF] | |
| JC JC | 1,399,590 | IS5 (+) +4 bp | intergenic (‑64/+128) | fnr ← / ← ogt | DNA‑binding transcriptional dual regulator FNR/methylated‑DNA‑‑[protein]‑cysteine S‑methyltransferase |
| RA | 1,401,893 | G→A | Q455* (CAA→TAA) | abgB ← | p‑aminobenzoyl‑glutamate hydrolase subunit B |
| RA | 1,453,992 | G→A | W22* (TGG→TGA) | paaA → | phenylacetyl‑CoA 1,2‑epoxidase, monooxygenase subunit |
| RA | 1,597,364 | T→C | intergenic (‑4922/+1253) | hipB ← / ← lsrK | antitoxin/DNA‑binding transcriptional repressor HipB/autoinducer‑2 kinase |
| RA | 1,643,679 | A→T | L209Q (CTG→CAG) | ydfU ← | protein YdfU |
| RA | 1,652,331 | T→C | intergenic (+2346/+397) | ydfD → / ← ynfP | lysis protein/protein YnfP |
| JC | 1,679,563 | (TATCACGTTTTAATCACTGGATATCGATGGAAA)1→2 | coding (7/1383 nt) | ydgI → | putative arginine:ornithine antiporter |
| RA | 1,721,136 | C→T | L38F (CTT→TTT) | ydhI → | DUF1656 domain‑containing protein YdhI |
| RA | 1,776,100 | G→A | E172K (GAA→AAA) | ydiF → | putative acetate‑CoA transferase YdiF |
| RA | 1,776,715 | A→T | S377C (AGT→TGT) | ydiF → | putative acetate‑CoA transferase YdiF |
| RA | 1,894,839 | T→C | L12P (CTC→CCC) | pabB → | aminodeoxychorismate synthase subunit 1 |
| RA | 1,955,010 | G→A | D666D (GAC→GAT) | torZ ← | trimethylamine N‑oxide reductase 2 |
| MC JC | 1,978,503 | Δ776 bp | insB5–insA5 | insB5, insA5 | |
| RA | 1,994,637 | A→G | Y24H (TAC→CAC) | uvrC ← | UvrABC excision nuclease subunit C |
| RA | 2,040,433 | C→A | A319D (GCC→GAC) | msrP → | protein‑L‑methionine sulfoxide reductase catalytic subunit MsrP |
| RA | 2,041,411 | G→A | G13S (GGT→AGT) | zinT → | metal‑binding protein ZinT |
| RA | 2,046,506 | G→T | V523V (GTG→GTT) | yeeJ → | inverse autotransporter adhesin |
| RA | 2,085,319 | G→A | A69A (GCC→GCT) | tsuA ← | thiosulfate transporter |
| RA | 2,086,634 | G→A | A143A (GCC→GCT) | plaP ← | putrescine:H(+) symporter PlaP |
| RA | 2,103,891 | G→A | P207S (CCA→TCA) | wbbK ← | putative glycosyltransferase WbbK |
| RA | 2,111,259 | Δ1 bp | coding (718/900 nt) | rfbD ← | dTDP‑4‑dehydrorhamnose reductase |
| RA | 2,122,908 | G→A | I24I (ATC→ATT) | cpsG ← | phosphomannomutase |
| RA | 2,134,498 | G→A | V385V (GTC→GTT) | wzc ← | protein‑tyrosine kinase Wzc |
| RA | 2,137,543 | G→A | intergenic (‑300/‑359) | wza ← / → yegH | outer membrane polysaccharide export protein Wza/inner membrane protein YegH |
| RA | 2,173,363 | Δ2 bp | intergenic (‑490/+918) | gatD ← / ← gatB | galactitol‑1‑phosphate 5‑dehydrogenase/galactitol‑specific PTS enzyme IIB component |
| RA | 2,173,448 | C→T | intergenic (‑575/+834) | gatD ← / ← gatB | galactitol‑1‑phosphate 5‑dehydrogenase/galactitol‑specific PTS enzyme IIB component |
| JC JC | 2,174,359 | IS5 (+) +4 bp | coding (205‑208/285 nt) | gatB ← | galactitol‑specific PTS enzyme IIB component |
| RA | 2,188,087 | T→C | T110A (ACG→GCG) | yehA ← | putative fimbrial adhesin YehA |
| RA | 2,304,522 | 2 bp→TC | intergenic (+129/+585) | eco → / ← mqo | serine protease inhibitor ecotin/malate:quinone oxidoreductase |
| RA | 2,329,209 | A→G | W197R (TGG→CGG) | yfaQ ← | tandem DUF2300 domain‑containing protein YfaQ |
| RA | 2,339,162 | C→T | D87N (GAC→AAC) | gyrA ← | DNA gyrase subunit A |
| JC JC | 2,378,926 | IS5 (–) +4 bp | coding (331‑334/1671 nt) | menD ← | 2‑succinyl‑5‑enolpyruvyl‑6‑hydroxy‑3‑ cyclohexene‑1‑carboxylate synthase |
| RA | 2,384,808 | C→T | K305K (AAG→AAA) | yfbK ← | IPR002035/DUF3520 domain‑containing protein YfbK |
| RA | 2,410,419 | G→A | L312L (CTG→TTG) | yfbS ← | putative transporter YfbS |
| RA | 2,484,827 | C→T | L152F (CTT→TTT) | evgS → | sensor histidine kinase EvgS |
| RA | 2,510,609 | C→T | P327L (CCG→CTG) | yfeO → | putative transport protein YfeO |
| RA | 2,587,112 | C→T | A461V (GCA→GTA) | narQ → | sensor histidine kinase NarQ |
| RA | 2,732,992 | G→A | I394I (ATC→ATT) I394I (ATC→ATT) |
clpB ← clpB ← |
chaperone protein ClpB chaperone protein ClpB |
| RA | 2,823,537 | A→G | L78P (CTG→CCG) | recA ← | DNA recombination/repair protein RecA |
| RA | 2,856,243 | A→G | T636A (ACG→GCG) | fhlA → | DNA‑binding transcriptional activator FhlA |
| RA | 2,867,454 | T→A | Q33L (CAG→CTG) | rpoS ← | RNA polymerase sigma factor RpoS |
| RA | 2,871,153 | T→G | N51T (AAC→ACC) | truD ← | tRNA pseudouridine(13) synthase |
| RA | 2,926,543 | 2 bp→TT | coding (236‑237/1365 nt) | ppnN → | nucleotide 5'‑monophosphate nucleosidase |
| RA | 2,926,772 | C→A | G155G (GGC→GGA) | ppnN → | nucleotide 5'‑monophosphate nucleosidase |
| JC JC | 2,993,231 | IS5 (–) +4 bp | coding (1138‑1141/1377 nt) | ygeH → | putative transcriptional regulator YgeH |
| RA | 3,028,546 | G→A | A156V (GCC→GTC) | ygfS ← | putative electron transport protein YgfS |
| RA | 3,050,472 | G→A | L66L (CTG→TTG) | gcvT ← | aminomethyltransferase |
| RA | 3,061,916 | C→T | A356V (GCC→GTC) | scpA → | methylmalonyl‑CoA mutase |
| RA | 3,065,449 | G→A | L216L (TTG→TTA) | scpC → | propionyl‑CoA:succinate CoA transferase |
| RA | 3,065,861 | G→A | V354I (GTC→ATC) | scpC → | propionyl‑CoA:succinate CoA transferase |
| RA | 3,089,260 | T→C | V326A (GTG→GCG) | galP → | galactose:H(+) symporter |
| RA | 3,090,968 | G→A | E208K (GAG→AAG) | endA → | DNA‑specific endonuclease I |
| RA | 3,104,887 | G→A | S152N (AGC→AAC) | mltC → | membrane‑bound lytic murein transglycosylase C |
| RA | 3,120,786 | G→A | T165I (ACT→ATT) | glcA ← | glycolate/lactate:H(+) symporter GlcA |
| RA | 3,121,033 | T→C | I83V (ATT→GTT) | glcA ← | glycolate/lactate:H(+) symporter GlcA |
| RA | 3,127,981 | G→A | P14L (CCC→CTC) | glcD ← | glycolate dehydrogenase, putative FAD‑linked subunit |
| RA | 3,130,161 | G→A | L19F (CTT→TTT) | yghO ← | putative DNA‑binding transcriptional regulator YghO |
| RA | 3,132,077 | G→A | A111V (GCG→GTG) | yghQ ← | putative transport protein YghQ |
| RA | 3,133,175 | G→A | T13I (ACC→ATC) | yghR ← | putative ATP‑binding protein YghR |
| RA | 3,134,263 | G→A | A45T (GCC→ACC) | yghT → | putative ATP‑binding protein YghT |
| RA | 3,145,944 | G→A | L106L (CTC→CTT) | hybO ← | hydrogenase 2 small subunit |
| RA | 3,150,316 | G→A | E219K (GAG→AAG) | yghA → | NADP(+)‑dependent aldehyde reductase |
| RA | 3,162,216 | G→A | Q152* (CAG→TAG) | ftsP ← | cell division protein FtsP |
| RA | 3,176,625 | G→A | S70F (TCC→TTC) | cpdA ← | cAMP phosphodiesterase |
| RA | 3,179,383 | G→A | K423K (AAG→AAA) | tolC → | outer membrane channel TolC |
| RA | 3,193,351 | G→A | G163E (GGG→GAG) | yqiK → | flotillin family inner membrane protein YqiK |
| RA | 3,204,617 | G→A | intergenic (‑28/‑77) | folB ← / → plsY | dihydroneopterin aldolase/putative glycerol‑3‑phosphate acyltransferase |
| RA | 3,207,549 | Δ1 bp | coding (179/606 nt) | ttdB → | L(+)‑tartrate dehydratase subunit beta |
| RA | 3,219,128 | G→A | intergenic (‑52/‑366) | aer ← / → patA | aerotaxis receptor/putrescine aminotransferase |
| RA | 3,224,895 | C→T | L755L (CTG→TTG) | ebgA → | evolved beta‑D‑galactosidase subunit alpha |
| RA | 3,227,339 | C→T | T369I (ACC→ATC) | ygjI → | putative transporter YgjI |
| RA | 3,240,423 | C→T | G160G (GGC→GGT) | sstT → | serine/threonine:Na(+) symporter |
| RA | 3,256,157 | C→T | Q165Q (CAG→CAA) | cyuA ← | putative L‑cysteine desulfidase CyuA |
| RA | 3,259,283 | G→A | H123Y (CAT→TAT) | tdcG ← | L‑serine deaminase III |
| RA | 3,270,497 | C→T | noncoding (96/377 nt) | rnpB ← | RNase P catalytic RNA component |
| RA | 3,275,902 | A→T | E207D (GAA→GAT) | garD → | GarD |
| RA | 3,292,312 | C→T | P324P (CCC→CCT) | yraK → | putative fimbrial adhesin YraK |
| RA | 3,304,647 | T→C | I391V (ATT→GTT) | mtr ← | tryptophan:H(+) symporter Mtr |
| RA | 3,329,743 | G→T | D261Y (GAT→TAT) | dacB → | peptidoglycan DD‑endopeptidase DacB |
| JC JC | 3,368,685 | IS2 (–) +5 bp | coding (859‑863/1128 nt) | yhcG → | DUF1016 domain‑containing protein YhcG |
| RA | 3,377,240 | T→G | T61P (ACC→CCC) | sspA ← | stringent starvation protein A |
| RA | 3,388,041 | T→G | T50P (ACG→CCG) | aaeB ← | aromatic carboxylic acid efflux pump subunit AaeB |
| RA | 3,506,393 | T→C | D315G (GAC→GGC) | yhfT ← | uncharacterized protein YhfT |
| RA | 3,524,184 | C→T | A438A (GCC→GCT) | mrcA → | peptidoglycan glycosyltransferase/peptidoglycan DD‑transpeptidase MrcA |
| RA | 3,558,291 | C→T | G8G (GGC→GGT) | rtcR → | DNA‑binding transcriptional activator RtcR |
| RA | 3,559,621 | C→T | P452S (CCC→TCC) | rtcR → | DNA‑binding transcriptional activator RtcR |
| RA | 3,560,119 | A→G | intergenic (+253/+503) | rtcR → / ← glpG | DNA‑binding transcriptional activator RtcR/rhomboid protease GlpG |
| RA | 3,560,455 | +G | intergenic (+589/+167) | rtcR → / ← glpG | DNA‑binding transcriptional activator RtcR/rhomboid protease GlpG |
| RA | 3,579,050 | G→A | A199V (GCC→GTC) | yhhW ← | quercetin 2,3‑dioxygenase |
| RA | 3,581,316 | G→A | G60E (GGA→GAA) | yhhY → | N‑acetyltransferase YhhY |
| RA | 3,581,850 | G→A | intergenic (+224/‑13) | yhhY → / → yhhZ | N‑acetyltransferase YhhY/putative endonuclease YhhZ |
| RA | 3,585,517 | G→A | A436V (GCC→GTC) | ggt ← | glutathione hydrolase proenzyme |
| RA | 3,587,531 | G→A | L195F (CTC→TTC) | ugpQ ← | glycerophosphodiester phosphodiesterase UgpQ |
| RA | 3,588,787 | G→A | P132S (CCG→TCG) | ugpC ← | sn‑glycerol 3‑phosphate ABC transporter ATP binding subunit |
| RA | 3,589,956 | G→A | L24L (CTC→CTT) | ugpE ← | sn‑glycerol 3‑phosphate ABC transporter membrane subunit UgpE |
| RA | 3,621,090 | C→T | R633R (CGC→CGT) | rhsB → | rhs element protein RhsB |
| RA | 3,647,677 | C→T | intergenic (+26/+28) | gor → / ← dinQ | glutathione reductase (NADPH)/membrane toxin DinQ |
| RA | 3,707,883 | G→A | intergenic (‑178/+733) | dppA ← / ← proK | dipeptide ABC transporter periplasmic binding protein/tRNA‑Pro |
| RA | 3,707,947 | C→A | intergenic (‑242/+669) | dppA ← / ← proK | dipeptide ABC transporter periplasmic binding protein/tRNA‑Pro |
| RA | 3,725,176 | T→G | E48A (GAG→GCG) | glyQ ← | glycine‑‑tRNA ligase subunit alpha |
| RA | 3,815,883 | +C | coding (667/687 nt) | rph ← | truncated RNase PH |
| RA | 3,827,026 | C→T | A606V (GCG→GTG) | recG → | ATP‑dependent DNA helicase RecG |
| RA | 3,927,292 | T→C | D46D (GAT→GAC) | asnA → | asparagine synthetase A |
| RA | 3,937,909 | G→A | A206T (GCG→ACG) | rbsK → | ribokinase |
| RA | 3,937,997 | G→A | G235D (GGT→GAT) | rbsK → | ribokinase |
| RA | 3,938,441 | Δ1 bp | coding (215/993 nt) | rbsR → | DNA‑binding transcriptional dual regulator RbsR |
| RA | 3,941,874 | C→T | noncoding (67/1542 nt) | rrsC → | 16S ribosomal RNA |
| RA | 3,946,246 | G→A | noncoding (2543/2904 nt) | rrlC → | 23S ribosomal RNA |
| RA | 3,950,099 | C→T | intergenic (‑130/‑223) | yifB ← / → ilvL | putative magnesium chelatase YifB/ilvXGMEDA operon leader peptide |
| RA | 3,956,003 | G→A | D225N (GAT→AAT) | ilvA → | threonine deaminase |
| RA | 4,084,932 | G→T | F297L (TTC→TTA) | fdoG ← | formate dehydrogenase O subunit alpha |
| RA | 4,139,298 | G→A | A137A (GCC→GCT) | fsaB ← | fructose‑6‑phosphate aldolase 2 |
| RA | 4,160,157 | G→A | L212L (CTG→TTG) | sthA ← | soluble pyridine nucleotide transhydrogenase |
| RA | 4,171,728 | C→T | noncoding (92/120 nt) | rrfB → | 5S ribosomal RNA |
| RA | 4,175,827 | C→T | noncoding (74/76 nt) | thrT → | tRNA‑Thr |
| RA | 4,178,883 | C→T | A2V (GCT→GTT) | rplA → | 50S ribosomal subunit protein L1 |
| RA | 4,179,001 | C→T | S41S (AGC→AGT) | rplA → | 50S ribosomal subunit protein L1 |
| RA | 4,185,777 | C→T | S143F (TCC→TTC) | rpoC → | RNA polymerase subunit beta' |
| RA | 4,193,177 | C→T | E134K (GAG→AAG) | thiF ← | sulfur carrier protein ThiS adenylyltransferase |
| RA | 4,193,820 | C→T | G129R (GGA→AGA) | thiE ← | thiamine phosphate synthase |
| RA | 4,219,752 | C→T | S386F (TCC→TTC) | aceK → | isocitrate dehydrogenase kinase/phosphatase |
| RA | 4,222,743 | C→T | intergenic (‑256/+61) | arpA ← / ← iclR | regulator of acetyl CoA synthetase/DNA‑binding transcriptional repressor IclR |
| RA | 4,223,638 | T→C | intergenic (‑10/‑190) | iclR ← / → metH | DNA‑binding transcriptional repressor IclR/cobalamin‑dependent methionine synthase |
| RA | 4,224,483 | C→T | S219F (TCC→TTC) | metH → | cobalamin‑dependent methionine synthase |
| RA | 4,234,479 | C→T | A241V (GCG→GTG) | pgi → | glucose‑6‑phosphate isomerase |
| RA | 4,249,684 | C→T | A44V (GCT→GTT) | malM → | maltose regulon periplasmic protein |
| RA | 4,265,668 | C→T | T452I (ACC→ATC) | dnaB → | replicative DNA helicase |
| RA | 4,269,449 | C→T | C12C (TGC→TGT) | aphA → | acid phosphatase/phosphotransferase |
| RA | 4,271,130 | C→T | E914E (GAG→GAA) | uvrA ← | UvrABC excision nuclease subunit A |
| RA | 4,278,488 | C→T | P4S (CCA→TCA) | ghxP → | guanine/hypoxanthine transporter GhxP |
| RA | 4,282,536 | C→T | Q180Q (CAG→CAA) | yjcF ← | pentapeptide repeat‑containing protein YjcF |
| RA | 4,284,077 | C→T | A276T (GCG→ACG) | actP ← | acetate/glycolate:cation symporter |
| RA | 4,286,033 | C→T | A447T (GCG→ACG) | acs ← | acetyl‑CoA synthetase (AMP‑forming) |
| RA | 4,296,187 | C→T | intergenic (+393/+249) | gltP → / ← yjcO | glutamate/aspartate : H(+) symporter GltP/Sel1 repeat‑containing protein YjcO |
| RA | 4,296,300 | C→T | intergenic (+506/+136) | gltP → / ← yjcO | glutamate/aspartate : H(+) symporter GltP/Sel1 repeat‑containing protein YjcO |
| RA | 4,296,381 | +GC | intergenic (+587/+55) | gltP → / ← yjcO | glutamate/aspartate : H(+) symporter GltP/Sel1 repeat‑containing protein YjcO |
| RA | 4,297,469 | C→T | G633D (GGC→GAC) | fdhF ← | formate dehydrogenase H |
| RA | 4,298,199 | C→T | A390T (GCA→ACA) | fdhF ← | formate dehydrogenase H |
| RA | 4,301,071 | C→T | A670T (GCA→ACA) | mdtO ← | putative multidrug efflux pump subunit MdtO |
| RA | 4,303,755 | C→T | V119I (GTT→ATT) | mdtN ← | putative multidrug efflux pump membrane fusion protein |
| RA | 4,311,337 | C→T | A236T (GCA→ACA) | alsB ← | D‑allose ABC transporter periplasmic binding protein |
| RA | 4,320,079 | C→T | Q195Q (CAG→CAA) | phnI ← | carbon‑phosphorus lyase core complex subunit PhnI |
| RA | 4,320,785 | C→T | E155K (GAG→AAG) | phnH ← | carbon‑phosphorus lyase core complex subunit PhnH |
| RA | 4,322,605 | C→T | intergenic (‑183/+731) | phnF ← / ← phnD | putative transcriptional regulator PhnF/phosphonate/phosphate ABC transporter periplasmic binding protein |
| RA | 4,325,644 | C→T | S33N (AGC→AAC) | yjdN ← | PF06983 family protein YjdN |
| RA | 4,325,837 | C→T | intergenic (‑96/+562) | yjdN ← / ← yjdM | PF06983 family protein YjdN/zinc ribbon domain‑containing protein YjdM |
| RA | 4,332,310 | C→T | G321G (GGG→GGA) | basS ← | sensor histidine kinase BasS |
| RA | 4,337,864 | C→T | V22V (GTG→GTA) | adiY ← | DNA‑binding transcriptional activator AdiY |
| RA | 4,342,825 | C→T | N305N (AAC→AAT) | melA → | alpha‑galactosidase |
| JC JC | 4,348,862 | IS5 (+) +4 bp | intergenic (‑118/+450) | dcuB ← / ← dcuR | anaerobic C4‑dicarboxylate transporter DcuB/DNA‑binding transcriptional activator DcuR |
| RA | 4,349,259 | C→T | intergenic (‑515/+56) | dcuB ← / ← dcuR | anaerobic C4‑dicarboxylate transporter DcuB/DNA‑binding transcriptional activator DcuR |
| RA | 4,351,519 | C→T | T48T (ACG→ACA) | dcuS ← | sensor histidine kinase DcuS |
| RA | 4,351,590 | C→T | V25I (GTC→ATC) | dcuS ← | sensor histidine kinase DcuS |
| RA | 4,359,909 | C→T | W41* (TGG→TGA) | cadB ← | lysine:cadaverine antiporter |
| RA | 4,364,798 | C→T | G82D (GGC→GAC) | dsbD ← | thiol‑disulfide exchange protein DsbD |
| RA | 4,366,668 | C→T | A36T (GCC→ACC) | dcuA ← | C4‑dicarboxylate transporter DcuA |
| RA | 4,371,401 | C→T | A126V (GCT→GTT) | groL → | chaperonin GroEL |
| RA | 4,373,421 | C→T | A272T (GCG→ACG) | yjeJ ← | protein YjeJ |
| RA | 4,380,469 | C→T | E17K (GAA→AAA) | frdB ← | fumarate reductase iron‑sulfur protein |
| RA | 4,388,120 | C→T | A417A (GCG→GCA) | mscM ← | miniconductance mechanosensitive channel MscM |
| RA | 4,389,838 | C→T | V175M (GTG→ATG) | psd ← | phosphatidylserine decarboxylase proenzyme |
| RA | 4,401,607 | C→T | T312T (ACC→ACT) | hflX → | ribosome rescue factor HflX |
| RA | 4,403,010 | C→T | R325C (CGT→TGT) | hflK → | regulator of FtsH protease |
| RA | 4,407,045 | C→T | A131V (GCT→GTT) | rnr → | RNase R |
| RA | 4,414,625 | C→T | R117R (CGC→CGT) | aidB → | putative acyl‑CoA dehydrogenase AidB |
| RA | 4,418,862 | C→T | G255D (GGT→GAT) | ulaG ← | L‑ascorbate‑6‑phosphate lactonase |
| RA | 4,426,929 | C→T | C165Y (TGC→TAC) | yjfZ ← | DUF2686 domain‑containing protein YjfZ |
| RA | 4,433,459 | C→T | G189D (GGC→GAC) | qorB ← | NAD(P)H:quinone oxidoreductase |
| JC JC | 4,434,629 | IS1 (–) +8 bp | coding (1930‑1937/1944 nt) | cpdB ← | 2',3'‑cyclic‑nucleotide 2'‑phosphodiesterase/3'‑nucleotidase |
| RA | 4,435,124 | C→T | W481* (TGG→TAG) | cpdB ← | 2',3'‑cyclic‑nucleotide 2'‑phosphodiesterase/3'‑nucleotidase |
| RA | 4,435,750 | C→T | G272G (GGG→GGA) | cpdB ← | 2',3'‑cyclic‑nucleotide 2'‑phosphodiesterase/3'‑nucleotidase |
| RA | 4,451,280 | C→T | P75S (CCG→TCG) | ytfR → | galactofuranose ABC transporter putative ATP binding subunit |
| RA | 4,457,392 | C→T | E158E (GAG→GAA) | yjgA ← | putative ribosome biogenesis factor YjgA |
| RA | 4,482,901 | C→T | V313M (GTG→ATG) | valS ← | valine‑‑tRNA ligase |
| RA | 4,486,869 | T→A | L218M (TTG→ATG) | lptF → | lipopolysaccharide transport system protein LptF |
| RA | 4,487,022 | C→T | R269C (CGT→TGT) | lptF → | lipopolysaccharide transport system protein LptF |
| RA | 4,489,775 | C→T | V97M (GTG→ATG) | yjgR ← | DUF853 domain‑containing protein YjgR |
| RA | 4,494,499 | C→T | intergenic (‑93/‑124) | idnD ← / → idnK | L‑idonate 5‑dehydrogenase/D‑gluconate kinase, thermosensitive |
| RA | 4,501,500 | C→T | L81L (CTG→TTG) | yjgZ → | uncharacterized protein YjgZ |
| RA | 4,510,238 | T→G | intergenic (+445/+452) | insO → / ← fecE | IS911B regulator fragment/ferric citrate ABC transporter ATP binding subunit |
| RA | 4,517,355 | C→T | Q121Q (CAG→CAA) | fecR ← | ferric citrate regulator FecR |
| RA | 4,524,401 | C→T | G204S (GGC→AGC) | yjhH ← | putative 2‑dehydro‑3‑deoxy‑D‑pentonate aldolase |
| RA | 4,524,596 | C→T | D139N (GAT→AAT) | yjhH ← | putative 2‑dehydro‑3‑deoxy‑D‑pentonate aldolase |
| RA | 4,529,039 | C→T | G402D (GGT→GAT) | sgcC ← | putative PTS enzyme IIC component SgcC |
| RA | 4,530,797 | C→T | Q285Q (CAG→CAA) | sgcX ← | putative endoglucanase with Zn‑dependent exopeptidase domain |
| RA | 4,541,261 | C→T | A102V (GCT→GTT) | fimB → | Type 1 fimbriae regulatory protein FimB |
| JC JC | 4,542,042 | IS1 (+) +8 bp | coding (6‑13/597 nt) | fimE → | regulator for fimA |
| RA | 4,553,671 | C→T | F257F (TTC→TTT) | uxuB → | D‑mannonate oxidoreductase |
| RA | 4,564,385 | C→T | S102N (AGC→AAC) | yjiL ← | putative ATPase, activator of (R)‑hydroxyglutaryl‑CoA dehdratase |
| RA | 4,570,550 | C→T | S342N (AGC→AAC) | yjiR ← | fused putative DNA‑binding transcriptional regulator/putative aminotransferase YjiR |
| RA | 4,571,280 | C→T | E99K (GAG→AAG) | yjiR ← | fused putative DNA‑binding transcriptional regulator/putative aminotransferase YjiR |
| RA | 4,585,673 | C→T | W363* (TGG→TGA) | hsdR ← | type I restriction enzyme EcoKI endonuclease subunit |
| RA | 4,587,365 | C→T | S139S (AGC→AGT) | mrr → | Type IV methyl‑directed restriction enzyme EcoKMrr |
| RA | 4,604,517 | C→T | L120L (CTG→TTG) | bglJ → | DNA‑binding transcriptional regulator BglJ |
| RA | 4,636,925 | G→C | R77P (CGC→CCC) | creC → | sensory histidine kinase CreC |
| RA | 4,638,240 | G→A | L21L (TTG→TTA) | creD → | putative inner membrane protein CreD |
| Unassigned missing coverage evidence | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| seq id | start | end | size | ←reads | reads→ | gene | description | |||
| * | * | ÷ | NC_000913 | 565829 | 577187 | 11359 | 33 [0] | [0] 32 | [intD]–nmpC | [intD],renD,insE3,insF3,renD,emrE,ylcJ,ybcK,ybcL,ybcM,ylcH,ybcN,ninE,ybcO,rusA,ylcG,quuD,nmpC,insH2,nmpC |
| * | * | ÷ | NC_000913 | 1196375 | 1211412 | 15038 | 2 [0] | [0] 3 | C0293–mcrA | C0293,ymfD,ymfE,lit,intE,xisE,ymfH,ymfI,ymfJ,ymfK,ymfT,ymfL,ymfM,ymfN,ymfR,beeE,ymfQ,ycfK,tfaP,tfaE,pinE,mcrA |
| * | * | ÷ | NC_000913 | 2558699 | 2565482 | 6784 | 40 [0] | [1] 2 | intZ–[eutA] | intZ,yffL,yffM,yffN,yffO,yffP,yffQ,yffR,yffS,[eutA] |
| * | * | ÷ | NC_000913 | 3423897–3424234 | 3424406–3424239 | 6–510 | 2 [1] | [1] 2 | rrlD | 23S ribosomal RNA |
| Unassigned new junction evidence | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
| * | ? | NC_000913 | = 249545 | 66 (1.490) | 60 (1.390) | 52/470 | 0.1 | 48.8% | intergenic (+1411/‑1353) | rayT/dinB | REP‑associated tyrosine transposase/DNA polymerase IV |
| ? | NC_000913 | 373870 = | 62 (1.440) | coding (950/951 nt) coding (3/1014 nt) |
mhpF mhpE |
acetaldehyde dehydrogenase (acetylating) MhpF 4‑hydroxy‑2‑oxovalerate aldolase |
|||||
| * | ? | NC_000913 | 273955 = | NA (NA) | 33 (0.740) | 31/484 | 0.4 | 100% | noncoding (1195/1195 nt) | IS5 | repeat region |
| ? | NC_000913 | = 565828 | 0 (0.000) | coding (151/1164 nt) | intD | putative integrase | |||||
| * | ? | NC_000913 | = 275149 | NA (NA) | 32 (0.720) | 32/484 | 0.4 | 100% | noncoding (1/1195 nt) | IS5 | repeat region |
| ? | NC_000913 | 577188 = | 0 (0.000) | intergenic (‑363/‑210) | nmpC/essD | putative outer membrane porin NmpC/putative phage lysis protein | |||||
| * | ? | NC_000913 | 290634 = | NA (NA) | 3 (0.070) | 3/484 | 2.9 | 50.0% | noncoding (768/768 nt) | IS1 | repeat region |
| ? | NC_000913 | = 4434636 | 3 (0.070) | coding (1930/1944 nt) | cpdB | 2',3'‑cyclic‑nucleotide 2'‑phosphodiesterase/3'‑nucleotidase | |||||
| * | ? | NC_000913 | = 2558698 | 0 (0.000) | 40 (0.930) | 37/468 | 0.2 | 100% | intergenic (‑19/‑160) | eutB/intZ | ethanolamine ammonia‑lyase subunit alpha/putative phage integrase IntZ |
| ? | NC_000913 | 2565489 = | 0 (0.000) | coding (1396/1404 nt) | eutA | ethanolamine ammonia‑lyase reactivase EutA | |||||
| * | ? | NC_000913 | 4542682 = | 2 (0.050) | 21 (0.490) | 18/466 | 0.9 | 95.6% | intergenic (+49/‑433) | fimE/fimA | regulator for fimA/type 1 fimbriae major subunit |
| ? | NC_000913 | 4542996 = | 0 (0.000) | intergenic (+363/‑119) | fimE/fimA | regulator for fimA/type 1 fimbriae major subunit | |||||
| * | ? | NC_000913 | = 4542690 | 0 (0.000) | 17 (0.400) | 15/466 | 1.1 | 100% | intergenic (+57/‑425) | fimE/fimA | regulator for fimA/type 1 fimbriae major subunit |
| ? | NC_000913 | = 4542986 | 0 (0.000) | intergenic (+353/‑129) | fimE/fimA | regulator for fimA/type 1 fimbriae major subunit | |||||