mutation predictions | marginal predictions | summary statistics | genome diff | command line log
|
breseq version 0.39.0
mutation predictions | marginal predictions | summary statistics | genome diff | command line log |
| Predicted mutations | |||||
|---|---|---|---|---|---|
| evidence | position | mutation | annotation | gene | description |
| RA | 246,747 | G→T | S12S (TCG→TCT) | yafL → | NlpC/P60 family protein YafL |
| MC JC | 257,908 | Δ776 bp | insB9–[crl] | insB9, insA9, [crl] | |
| RA | 284,535 | T→G | A445A (GCT→GCG) | yagF → | D‑xylonate dehydratase |
| RA | 313,543 | G→A | intergenic (‑301/‑1748) | ykgR ← / → insE1 | putative membrane protein YkgR/IS3 element protein InsE |
| RA | 339,935 | C→T | A56V (GCC→GTC) | yahH → | putative uncharacterized protein YahH |
| RA | 339,941 | C→T | T58I (ACT→ATT) | yahH → | putative uncharacterized protein YahH |
| RA | 339,958 | G→A | D64N (GAC→AAC) | yahH → | putative uncharacterized protein YahH |
| RA | 339,979 | G→A | V71M (GTG→ATG) | yahH → | putative uncharacterized protein YahH |
| RA | 339,986 | G→A | R73Q (CGA→CAA) | yahH → | putative uncharacterized protein YahH |
| JC JC | 458,790 | IS186 (–) +6 bp :: Δ1 bp | intergenic (+90/‑93) | clpX → / → lon | ATP‑dependent Clp protease ATP‑binding subunit ClpX/Lon protease |
| RA | 480,295 | 2 bp→AA | coding (13‑14/219 nt) | hha ← | hemolysin expression‑modulating protein Hha |
| RA | 535,582 | A→T | E556V (GAG→GTG) | gcl → | glyoxylate carboligase |
| RA | 537,531 | C→T | intergenic (+67/‑102) | glxR → / → ybbW | tartronate semialdehyde reductase 2/putative allantoin transporter |
| RA | 543,263 | 2 bp→GT | coding (783‑784/786 nt) | allE ← | (S)‑ureidoglycine aminohydrolase |
| RA | 554,493 | G→A | intergenic (‑56/‑118) | ppiB ← / → cysS | peptidyl‑prolyl cis‑trans isomerase B/cysteine‑‑tRNA ligase |
| RA | 628,569 | A→G | N7D (AAT→GAT) | entA → | 2,3‑dihydro‑2,3‑dihydroxybenzoate dehydrogenase |
| RA | 659,517 | G→A | L234L (CTG→TTG) | lipA ← | lipoyl synthase |
| RA | 659,527 | G→T | T230T (ACC→ACA) | lipA ← | lipoyl synthase |
| RA | 696,470 | C→T | noncoding (35/75 nt) | glnX ← | tRNA‑Gln |
| RA | 727,761 | C→T | E324E (GAG→GAA) | kdpA ← | K(+) transporting P‑type ATPase subunit KdpA |
| RA | 809,217 | 2 bp→AG | coding (40‑41/1290 nt) | bioA ← | adenosylmethionine‑8‑amino‑7‑oxononanoate aminotransferase |
| RA | 905,659 | C→T | F249F (TTC→TTT) | amiD → | N‑acetylmuramoyl‑L‑alanine amidase D |
| RA | 907,652 | C→T | E211K (GAG→AAG) | ybjT ← | putative NAD(P)‑binding protein YbjT |
| RA | 909,094 | G→A | L67L (CTC→CTT) | ltaE ← | low‑specificity L‑threonine aldolase |
| RA | 973,577 | C→T | S14F (TCC→TTC) | cmoM → | tRNA cmo(5)U34 methyltransferase |
| RA | 1,005,691 | T→A | I308I (ATT→ATA) | pyrD → | dihydroorotate dehydrogenase, type 2 |
| RA | 1,005,703 | C→T | A312A (GCC→GCT) | pyrD → | dihydroorotate dehydrogenase, type 2 |
| RA | 1,043,607 | G→A | L202L (CTG→TTG) | etk ← | protein‑tyrosine kinase Etk |
| RA | 1,050,092 | C→T | S87L (TCA→TTA) L22L (CTC→CTT) |
insA4 → insB4 → |
IS1 family protein InsA IS1 family protein InsB |
| RA | 1,146,079 | C→A | V173F (GTT→TTT) | yceF ← | m(7)GTP pyrophosphatase |
| RA | 1,157,902 | G→T | V12F (GTC→TTC) | ptsG → | glucose‑specific PTS enzyme IIBC component |
| RA | 1,169,836 | A→G | L180P (CTG→CCG) | ldtC ← | L,D‑transpeptidase LdtC |
| JC JC | 1,185,790 | IS2 (–) +5 bp | intergenic (‑196/‑50) | potA ← / → pepT | spermidine preferential ABC transporter ATP binding subunit/peptidase T |
| RA | 1,189,980 | A→G | T156T (ACT→ACC) | phoP ← | DNA‑binding transcriptional dual regulator PhoP |
| RA | 1,196,220 | C→T | H366H (CAC→CAT) | icd → | isocitrate dehydrogenase |
| RA | 1,196,232 | C→T | T370T (ACC→ACT) | icd → | isocitrate dehydrogenase |
| RA | 1,196,245 | T→C | L375M (TTA→CTG) | icd → | isocitrate dehydrogenase |
| RA | 1,196,247 | A→G | L375M (TTA→CTG) | icd → | isocitrate dehydrogenase |
| RA | 1,196,277 | C→T | N385N (AAC→AAT) | icd → | isocitrate dehydrogenase |
| RA | 1,196,280 | G→C | A386A (GCG→GCC) | icd → | isocitrate dehydrogenase |
| RA | 1,196,283 | A→G | K387K (AAA→AAG) | icd → | isocitrate dehydrogenase |
| RA | 1,196,304 | G→A | E394E (GAG→GAA) | icd → | isocitrate dehydrogenase |
| RA | 1,196,316 | T→A | D398E (GAT→GAA) | icd → | isocitrate dehydrogenase |
| RA | 1,220,493 | C→T | intergenic (+1292/+1812) | ymgF → / ← ymgD | inner membrane protein YmgF/PF16456 family protein YmgD |
| RA | 1,233,669 | G→A | S350F (TCT→TTT) | nhaB ← | Na(+):H(+) antiporter NhaB |
| RA | 1,290,947 | C→T | Q236* (CAA→TAA) | rssB → | regulator of RpoS |
| RA | 1,292,992 | A→C | intergenic (‑70/‑535) | hns ← / → tdk | DNA‑binding transcriptional dual regulator H‑NS/thymidine/deoxyuridine kinase |
| RA | 1,301,992 | A→T | N271Y (AAT→TAT) | oppA → | oligopeptide ABC transporter periplasmic binding protein |
| RA | 1,306,736 | T→G | S325A (TCC→GCC) | oppF → | murein tripeptide ABC transporter/oligopeptide ABC transporter ATP binding subunit OppF |
| RA | 1,337,394 | A→G | S522G (AGC→GGC) | acnA → | aconitate hydratase 1 |
| RA | 1,358,859 | T→C | Y110C (TAT→TGT) | puuP ← | putrescine:H(+) symporter PuuP |
| RA | 1,374,498 | G→T | G137C (GGC→TGC) | ycjP → | putative ABC transporter membrane subunit YcjP |
| RA | 1,405,758 | G→A | intergenic (‑7/‑221) | mcaS ← / → smrA | small regulatory RNA McaS/DNA endonuclease SmrA |
| JC JC | 1,419,427 | IS1 (–) +9 bp | coding (22‑30/135 nt) | ydaG ← | uncharacterized protein YdaG |
| RA | 1,425,329 | Δ1 bp | intergenic (+90/‑48) | trkG → / → ynaK | K(+) transporter TrkG/ParB‑like nuclease domain‑containing protein YnaK |
| RA | 1,433,144 | G→A | F177F (TTC→TTT) | pinR ← | putative site‑specific recombinase |
| RA | 1,531,689 | A→G | intergenic (‑1185/‑127) | yncO ← / → ydcC | protein YncO/H repeat‑associated putative transposase YdcC |
| RA | 1,553,630 | C→A | G70V (GGT→GTT) | adhP ← | ethanol dehydrogenase/alcohol dehydrogenase |
| RA | 1,555,731 | Δ1 bp | intergenic (‑62/+95) | maeA ← / ← sra | malate dehydrogenase (oxaloacetate‑decarboxylating)/ribosome‑associated protein Sra |
| RA | 1,600,234 | C→T | intergenic (‑25/+54) | lsrK ← / ← lsrR | autoinducer‑2 kinase/DNA‑binding transcriptional repressor LsrR |
| RA | 1,601,098 | C→A | S48S (TCG→TCT) | lsrR ← | DNA‑binding transcriptional repressor LsrR |
| RA | 1,601,103 | C→T | V47M (GTG→ATG) | lsrR ← | DNA‑binding transcriptional repressor LsrR |
| RA | 1,632,712 | A→G | intergenic (‑427/‑178) | ydfJ ← / → ynfT | putative transporter YdfJ/protein YnfT |
| RA | 1,641,002 | T→C | intergenic (+27/+337) | ynfU → / ← cspB | putative zinc‑binding protein YnfU/cold shock‑like protein CspB |
| RA | 1,643,679 | A→T | L209Q (CTG→CAG) | ydfU ← | protein YdfU |
| RA | 1,649,971 | C→T | P60S (CCG→TCG) | ydfD → | lysis protein |
| RA | 1,652,331 | T→C | intergenic (+2346/+397) | ydfD → / ← ynfP | lysis protein/protein YnfP |
| RA | 1,682,694 | A→T | Q179L (CAA→CTA) | rstA → | DNA‑binding transcriptional regulator RstA |
| RA | 1,702,757 | C→T | F175F (TTC→TTT) | add → | adenosine deaminase |
| RA | 1,776,715 | A→T | S377C (AGT→TGT) | ydiF → | putative acetate‑CoA transferase YdiF |
| RA | 1,894,839 | T→C | L12P (CTC→CCC) | pabB → | aminodeoxychorismate synthase subunit 1 |
| JC JC | 1,907,395 | IS1 (–) +9 bp | coding (33‑41/210 nt) | cspC ← | transcription antiterminator and regulator of mRNA stability CspC |
| RA | 1,909,387 | A→T | L238* (TTA→TAA) | kdgR ← | DNA‑binding transcriptional repressor KdgR |
| RA | 1,987,499 | C→A | intergenic (+71/+8) | ftnB → / ← yecJ | putative ferritin‑like protein/DUF2766 domain‑containing protein YecJ |
| JC | 2,014,041 | (TACGGCGCAGCTGGACTTCGCCAGT)1→2 | coding (813/1659 nt) | fliF → | flagellar basal‑body MS‑ring and collar protein |
| RA | 2,040,433 | C→A | A319D (GCC→GAC) | msrP → | protein‑L‑methionine sulfoxide reductase catalytic subunit MsrP |
| RA | 2,117,201 | C→T | E402K (GAA→AAA) | wcaK ← | colanic acid biosynthesis pyruvyl transferase WcaK |
| RA | 2,173,363 | Δ2 bp | intergenic (‑490/+918) | gatD ← / ← gatB | galactitol‑1‑phosphate 5‑dehydrogenase/galactitol‑specific PTS enzyme IIB component |
| RA | 2,239,943 | T→A | K136* (AAA→TAA) | mglB ← | D‑galactose/methyl‑galactoside ABC transporter periplasmic binding protein |
| RA | 2,330,263 | A→G | intergenic (‑466/+4073) | yfaQ ← / ← yfaT | tandem DUF2300 domain‑containing protein YfaQ/DUF1175 domain‑containing protein YfaT |
| RA | 2,384,808 | C→T | K305K (AAG→AAA) | yfbK ← | IPR002035/DUF3520 domain‑containing protein YfbK |
| RA | 2,410,419 | G→A | L312L (CTG→TTG) | yfbS ← | putative transporter YfbS |
| RA | 2,484,827 | C→T | L152F (CTT→TTT) | evgS → | sensor histidine kinase EvgS |
| RA | 2,674,147 | T→A | Q181L (CAG→CTG) | yphB ← | putative aldose 1‑epimerase YphB |
| RA | 2,848,629 | A→T | F205I (TTT→ATT) | hycC ← | formate hydrogenlyase subunit HycC |
| RA | 2,867,551 | T→G | M1M (ATG→CTG) † | rpoS ← | RNA polymerase sigma factor RpoS |
| JC JC | 2,913,392 | IS2 (–) +5 bp | coding (256‑260/2235 nt) | relA ← | GDP/GTP pyrophosphokinase |
| RA | 2,941,904 | G→A | H222Y (CAT→TAT) | gcvA ← | DNA‑binding transcriptional dual regulator GcvA |
| RA | 3,088,010 | 2 bp→TT | intergenic (+150/‑273) | metK → / → galP | methionine adenosyltransferase/galactose:H(+) symporter |
| RA | 3,218,844 | G→A | P78L (CCC→CTC) | aer ← | aerotaxis receptor |
| RA | 3,309,321 | A→G | T616T (ACT→ACC) | pnp ← | polynucleotide phosphorylase |
| RA | 3,336,411 | 2 bp→AT | coding (83‑84/1260 nt) | murA ← | UDP‑N‑acetylglucosamine 1‑carboxyvinyltransferase |
| RA | 3,388,041 | T→G | T50P (ACG→CCG) | aaeB ← | aromatic carboxylic acid efflux pump subunit AaeB |
| RA | 3,432,105 | C→T | L120L (CTG→CTA) | smg ← | DUF494 domain‑containing protein Smg |
| RA | 3,443,961 | G→A | A46V (GCC→GTC) | secY ← | Sec translocon subunit SecY |
| RA | 3,443,980 | G→A | P40S (CCG→TCG) | secY ← | Sec translocon subunit SecY |
| RA | 3,447,871 | +C | coding (279/372 nt) | rplN ← | 50S ribosomal subunit protein L14 |
| RA | 3,452,022 | G→A | P89S (CCG→TCG) | rplD ← | 50S ribosomal subunit protein L4 |
| RA | 3,452,218 | G→A | F23F (TTC→TTT) | rplD ← | 50S ribosomal subunit protein L4 |
| RA | 3,457,378 | C→T | L334L (CTC→CTT) | gspD → | Type II secretion system protein GspD |
| RA | 3,458,245 | A→C | S623S (TCA→TCC) | gspD → | Type II secretion system protein GspD |
| RA | 3,474,425 | T→G | K43T (AAA→ACA) | rpsL ← | 30S ribosomal subunit protein S12 |
| RA | 3,474,539 | T→C | N5S (AAC→AGC) | rpsL ← | 30S ribosomal subunit protein S12 |
| JC JC | 3,560,081 | IS1 (+) +9 bp | intergenic (+215/+533) | rtcR → / ← glpG | DNA‑binding transcriptional activator RtcR/rhomboid protease GlpG |
| RA | 3,560,095 | C→T | intergenic (+229/+527) | rtcR → / ← glpG | DNA‑binding transcriptional activator RtcR/rhomboid protease GlpG |
| RA | 3,560,455 | +G | intergenic (+589/+167) | rtcR → / ← glpG | DNA‑binding transcriptional activator RtcR/rhomboid protease GlpG |
| RA | 3,686,705 | G→A | F823F (TTC→TTT) | bcsC ← | cellulose synthase outer membrane channel |
| RA | 3,707,947 | C→A | intergenic (‑242/+669) | dppA ← / ← proK | dipeptide ABC transporter periplasmic binding protein/tRNA‑Pro |
| RA | 3,712,407 | G→A | G176G (GGC→GGT) | yhjY ← | putative outer membrane protein YhjY |
| RA | 3,725,176 | T→G | E48A (GAG→GCG) | glyQ ← | glycine‑‑tRNA ligase subunit alpha |
| RA | 3,729,955 | 2 bp→AA | coding (810‑811/1323 nt) | xylA ← | xylose isomerase |
| JC JC | 3,731,420 | IS1 (–) +9 bp | coding (290‑298/993 nt) | xylF → | xylose ABC transporter periplasmic binding protein |
| RA | 3,769,447 | G→A | E35K (GAA→AAA) | yibV → | PF15596 family protein YibV |
| RA | 3,773,040 | (G)6→4 | coding (760‑761/1914 nt) | mtlA → | mannitol‑specific PTS enzyme IICBA component |
| RA | 3,783,983 | G→A | S49F (TCC→TTC) | secB ← | protein export chaperone SecB |
| RA | 3,815,883 | +C | coding (667/687 nt) | rph ← | truncated RNase PH |
| RA | 3,865,885 | A→G | V130A (GTT→GCT) | yidE ← | putative transport protein YidE |
| RA | 3,899,195 | C→T | E67K (GAA→AAA) | yieK ← | putative glucosamine‑6‑phosphate deaminase YieK |
| RA | 3,903,234 | G→A | V156V (GTC→GTT) | bglB ← | 6‑phospho‑beta‑glucosidase B |
| RA | 3,961,662 | G→T | G329V (GGC→GTC) | rep → | ATP‑dependent DNA helicase Rep |
| RA | 3,965,174 | G→A | H153Y (CAC→TAC) | rhlB ← | ATP‑dependent RNA helicase RhlB |
| RA | 3,968,683 | G→A | M256I (ATG→ATA) | rfe → | UDP‑N‑acetylglucosamine‑‑undecaprenyl‑phosphate N‑acetylglucosaminephosphotransferase |
| RA | 3,969,748 | T→C | S240P (TCG→CCG) | wzzE → | enterobacterial common antigen polysaccharide co‑polymerase |
| RA | 3,999,664 | C→T | S561L (TCG→TTG) | uvrD → | DNA helicase II |
| RA | 4,009,698 | G→A | A177T (GCA→ACA) | pldB → | lysophospholipase L2 |
| RA | 4,017,197 | C→T | intergenic (+5/‑136) | udp → / → rmuC | uridine phosphorylase/putative recombination limiting protein RmuC |
| RA | 4,084,903 | T→G | N307T (AAC→ACC) | fdoG ← | formate dehydrogenase O subunit alpha |
| RA | 4,086,300 | A→C | E95D (GAA→GAC) | fdhD → | sulfurtransferase for molybdenum cofactor sulfuration |
| RA | 4,092,703 | A→G | F41L (TTC→CTC) | frvA ← | putative PTS enzyme IIA component FrvA |
| RA | 4,105,809 | G→A | intergenic (‑139/‑11) | cpxR ← / → cpxP | DNA‑binding transcriptional dual regulator CpxR/periplasmic protein CpxP |
| RA | 4,108,758 | T→C | intergenic (+244/‑76) | pfkA → / → sbp | 6‑phosphofructokinase 1/sulfate/thiosulfate ABC transporter periplasmic binding protein Sbp |
| RA | 4,113,851 | G→A | H208Y (CAT→TAT) | fpr ← | flavodoxin/ferredoxin‑NADP(+) reductase |
| RA | 4,143,377 | C→T | S283L (TCA→TTA) | frwC → | putative PTS enzyme IIC component FrwC |
| RA | 4,156,839 | G→A | intergenic (+50/‑11) | argB → / → argH | acetylglutamate kinase/argininosuccinate lyase |
| RA | 4,157,116 | Δ1 bp | coding (267/1374 nt) | argH → | argininosuccinate lyase |
| RA | 4,193,996 | T→G | D70A (GAT→GCT) | thiE ← | thiamine phosphate synthase |
| RA | 4,202,259 | G→A | G112R (GGG→AGG) | zraS → | sensor histidine kinase ZraS |
| RA | 4,215,347 | T→A | intergenic (+138/‑131) | metA → / → aceB | homoserine O‑succinyltransferase/malate synthase A |
| RA | 4,223,638 | T→C | intergenic (‑10/‑190) | iclR ← / → metH | DNA‑binding transcriptional repressor IclR/cobalamin‑dependent methionine synthase |
| RA | 4,293,781 | 2 bp→AT | coding (239‑240/597 nt) | nrfG → | putative formate‑dependent nitrite reductase complex subunit NrfG |
| RA | 4,296,381 | +GC | intergenic (+587/+55) | gltP → / ← yjcO | glutamate/aspartate : H(+) symporter GltP/Sel1 repeat‑containing protein YjcO |
| RA | 4,325,644 | C→T | S33N (AGC→AAC) | yjdN ← | PF06983 family protein YjdN |
| RA | 4,402,046 | G→A | W3* (TGG→TGA) | hflK → | regulator of FtsH protease |
| RA | 4,426,760 | G→A | I221I (ATC→ATT) | yjfZ ← | DUF2686 domain‑containing protein YjfZ |
| RA | 4,449,586 | G→A | P23S (CCG→TCG) | ppa ← | inorganic pyrophosphatase |
| RA | 4,452,714 | G→A | Q48Q (CAG→CAA) | ytfT → | galactofuranose ABC transporter putative membrane subunit YtfT |
| RA | 4,462,459 | G→A | Q68* (CAG→TAG) | nrdD ← | anaerobic ribonucleoside‑triphosphate reductase |
| RA | 4,473,900 | C→T | G52R (GGA→AGA) | bdcA ← | c‑di‑GMP‑binding biofilm dispersal mediator protein |
| RA | 4,475,493 | T→C | F19F (TTT→TTC) | yjgL → | protein YjgL |
| RA | 4,510,238 | T→G | intergenic (+445/+452) | insO → / ← fecE | IS911B regulator fragment/ferric citrate ABC transporter ATP binding subunit |
| RA | 4,546,601 | C→T | I502I (ATC→ATT) | fimD → | type I fimbriae usher protein |
| RA | 4,585,480 | G→A | Q428* (CAA→TAA) | hsdR ← | type I restriction enzyme EcoKI endonuclease subunit |
| RA | 4,636,925 | G→C | R77P (CGC→CCC) | creC → | sensory histidine kinase CreC |
| RA | 4,638,240 | G→A | L21L (TTG→TTA) | creD → | putative inner membrane protein CreD |
| Unassigned missing coverage evidence | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| seq id | start | end | size | ←reads | reads→ | gene | description | |||
| * | * | ÷ | NC_000913 | 576631 | 577298 | 668 | 4 [3] | [3] 4 | [nmpC] | [nmpC] |
| * | * | ÷ | NC_000913 | 578349 | 579183 | 835 | 4 [3] | [0] 31 | [rzpD]–borD | [rzpD],[rzoD],borD |
| * | * | ÷ | NC_000913 | 791603 | 792872 | 1270 | 23 [0] | [2] 36 | [galE]–[modF] | [galE],[modF] |
| * | * | ÷ | NC_000913 | 1094453–1095500 | 1106534 | 11035–12082 | 4 [3] | [3] 4 | [insF4]–[clsC] | [insF4],insE4,ycdU,serX,ghrA,ycdX,ycdY,ycdZ,csgG,csgF,csgE,csgD,csgB,csgA,csgC,ymdA,ymdB,[clsC] |
| * | * | ÷ | NC_000913 | 1106618 | 1107614 | 997 | 4 [2] | [0] 17 | clsC | cardiolipin synthase C |
| * | * | ÷ | NC_000913 | 1196351 | 1211423 | 15073 | 4 [3] | [3] 4 | [icd]–mcrA | [icd],C0293,ymfD,ymfE,lit,intE,xisE,ymfH,ymfI,ymfJ,ymfK,ymfT,ymfL,ymfM,ymfN,ymfR,beeE,ymfQ,ycfK,tfaP,tfaE,pinE,mcrA |
| * | * | ÷ | NC_000913 | 1632774 | 1633045–1632936 | 163–272 | 4 [3] | [3] 4 | ynfT | ynfT |
| * | * | ÷ | NC_000913 | 1978495 | 1979270–1978503 | 9–776 | 22 [0] | [0] 18 | insB5–insA5 | insB5,insA5 |
| * | * | ÷ | NC_000913 | 2151576 | 2151676 | 101 | 4 [2] | [2] 4 | [yegJ] | [yegJ] |
| * | * | ÷ | NC_000913 | 3423878–3424438 | 3424438 | 1–561 | 4 [3] | [3] 4 | [rrlD] | [rrlD] |
| Unassigned new junction evidence | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
| * | ? | NC_000913 | 257908 = | NA (NA) | 34 (1.170) | 31/484 | 0.1 | 94.4% | noncoding (768/768 nt) | IS1 | repeat region |
| ? | NC_000913 | 792873 = | 2 (0.070) | coding (916/1473 nt) | modF | ABC family protein ModF | |||||
| * | ? | NC_000913 | = 258675 | NA (NA) | 23 (0.790) | 22/484 | 0.3 | 100% | noncoding (1/768 nt) | IS1 | repeat region |
| ? | NC_000913 | = 791602 | 0 (0.000) | coding (454/1017 nt) | galE | UDP‑glucose 4‑epimerase | |||||
| * | ? | NC_000913 | = 275149 | NA (NA) | 31 (1.070) | 25/484 | 0.2 | 100% | noncoding (1/1195 nt) | IS5 | repeat region |
| ? | NC_000913 | 579184 = | 0 (0.000) | coding (411/411 nt) | ybcV | DUF1398 domain‑containing protein YbcV | |||||
| * | ? | NC_000913 | 315229 = | NA (NA) | 17 (0.590) +TCA |
16/478 | 0.7 | 100% | noncoding (1/1255 nt) | IS3 | repeat region |
| ? | NC_000913 | 1107615 = | 0 (0.000) | coding (1261/1422 nt) | clsC | cardiolipin synthase C | |||||
| * | ? | NC_000913 | = 1299498 | 0 (0.000) | 23 (0.840) | 20/460 | 0.4 | 100% | intergenic (+253/‑69) | ychE/insH21 | MarC family putative inner membrane protein YchE/IS5 family transposase and trans‑activator |
| ? | NC_000913 | = 1300693 | NA (NA) | noncoding (1195/1195 nt) | IS5 | repeat region | |||||
| * | ? | NC_000913 | 1299499 = | NA (NA) | 17 (0.620) | 17/460 | 0.6 | 100% | noncoding (1/1195 nt) | IS5 | repeat region |
| ? | NC_000913 | 1300694 = | 0 (0.000) | intergenic (+147/‑488) | insH21/oppA | IS5 family transposase and trans‑activator/oligopeptide ABC transporter periplasmic binding protein | |||||
| * | ? | NC_000913 | = 1397238 | NA (NA) | 22 (0.760) | 20/484 | 0.4 | 100% | noncoding (1195/1195 nt) | IS5 | repeat region |
| ? | NC_000913 | = 1978494 | 0 (0.000) | intergenic (‑297/+24) | flhD/insB5 | DNA‑binding transcriptional dual regulator FlhD/IS1 family protein InsB | |||||
| * | ? | NC_000913 | 1979271 = | 0 (0.000) | 18 (0.620) | 17/484 | 0.6 | 100% | intergenic (‑56/‑482) | insA5/uspC | IS1 family protein InsA/universal stress protein C |
| ? | NC_000913 | = 2102947 | NA (NA) | pseudogene (443/446 nt) | wbbL | interrupted rhamnosyltransferase WbbL | |||||
| * | ? | NC_000913 | = 4542690 | 14 (0.480) | 5 (0.180) | 5/466 | 2.3 | 25.3% | intergenic (+57/‑425) | fimE/fimA | regulator for fimA/type 1 fimbriae major subunit |
| ? | NC_000913 | = 4542986 | 16 (0.570) | intergenic (+353/‑129) | fimE/fimA | regulator for fimA/type 1 fimbriae major subunit | |||||