mutation predictions | marginal predictions | summary statistics | genome diff | command line log
|
breseq version 0.39.0
mutation predictions | marginal predictions | summary statistics | genome diff | command line log |
| Predicted mutations | |||||
|---|---|---|---|---|---|
| evidence | position | mutation | annotation | gene | description |
| RA | 70,659 | G→A | W91* (TGG→TGA) | araC → | DNA‑binding transcriptional dual regulator AraC |
| RA | 100,946 | T→C | M61T (ATG→ACG) | murC → | UDP‑N‑acetylmuramate‑‑L‑alanine ligase |
| RA | 246,747 | G→T | S12S (TCG→TCT) | yafL → | NlpC/P60 family protein YafL |
| MC JC | 257,908 | Δ776 bp | insB9–[crl] | insB9, insA9, [crl] | |
| RA | 284,535 | T→G | A445A (GCT→GCG) | yagF → | D‑xylonate dehydratase |
| JC JC | 303,857 | IS2 (–) +5 bp | coding (322‑326/330 nt) | ykgJ ← | putative metal‑chelating domain‑containing protein YkgJ |
| RA | 313,543 | G→A | intergenic (‑301/‑1748) | ykgR ← / → insE1 | putative membrane protein YkgR/IS3 element protein InsE |
| MC JC | 366,181 | Δ93 bp | coding (33‑125/3075 nt) | lacZ ← | beta‑galactosidase |
| RA | 367,573 | G→A | intergenic (‑63/+14) | lacI ← / ← mhpR | DNA‑binding transcriptional repressor LacI/DNA‑binding transcriptional activator MhpR |
| RA | 433,896 | T→C | Y148H (TAT→CAT) | ribD → | fused diaminohydroxyphosphoribosylaminopyrimidine deaminase/5‑amino‑6‑(5‑phosphoribosylamino)uracil reductase |
| RA | 471,115 | G→A | M160I (ATG→ATA) | mdlB → | ABC transporter family protein MdlB |
| RA | 480,295 | 2 bp→AA | coding (13‑14/219 nt) | hha ← | hemolysin expression‑modulating protein Hha |
| RA | 690,948 | G→A | V279V (GTC→GTT) | ybeX ← | CorC‑HlyC family protein YbeX |
| RA | 700,038 | G→A | H97Y (CAT→TAT) | umpH ← | UMP phosphatase |
| RA | 792,018 | C→T | G13E (GGA→GAA) | galE ← | UDP‑glucose 4‑epimerase |
| RA | 809,217 | 2 bp→AG | coding (40‑41/1290 nt) | bioA ← | adenosylmethionine‑8‑amino‑7‑oxononanoate aminotransferase |
| RA | 863,000 | G→T | S171Y (TCT→TAT) | ybiY ← | putative pyruvate formate‑lyase activating enzyme YbiY |
| JC JC | 882,207 | IS1 (–) +9 bp | coding (520‑528/759 nt) | deoR ← | DNA‑binding transcriptional repressor DeoR |
| RA | 883,396 | C→T | intergenic (‑8/‑277) | ybjG ← / → mdfA | undecaprenyl pyrophosphate phosphatase/multidrug efflux pump MdfA/Na(+):H(+) antiporter/K(+):H(+) antiporter |
| RA | 905,735 | C→T | Q275* (CAG→TAG) | amiD → | N‑acetylmuramoyl‑L‑alanine amidase D |
| RA | 968,837 | G→A | D158N (GAT→AAT) | lpxK → | tetraacyldisaccharide 4'‑kinase |
| RA | 1,031,775 | T→G | intergenic (‑63/‑364) | serT ← / → hyaA | tRNA‑Ser/hydrogenase 1 small subunit |
| RA | 1,040,126 | G→T | L277L (CTG→CTT) | appB → | cytochrome bd‑II subunit 2 |
| RA | 1,061,935 | Δ1 bp | coding (137/600 nt) | torD → | trimethylamine‑N‑oxide reductase‑specific chaperone |
| RA | 1,077,715 | C→A | E390* (GAG→TAG) | putA ← | fused DNA‑binding transcriptional repressor/proline dehydrogenase/1‑pyrroline‑5‑carboxylate dehydrogenase PutA |
| RA | 1,078,638 | G→T | A82D (GCC→GAC) | putA ← | fused DNA‑binding transcriptional repressor/proline dehydrogenase/1‑pyrroline‑5‑carboxylate dehydrogenase PutA |
| RA | 1,092,247 | C→A | A15S (GCT→TCT) | pgaA ← | partially deacetylated poly‑beta‑1,6‑N‑acetyl‑D‑glucosamine export outer membrane porin |
| RA | 1,098,620 | T→A | V245V (GTT→GTA) | ghrA → | glyoxylate/hydroxypyruvate reductase A |
| RA | 1,111,727 | 2 bp→TT | coding (865‑866/2544 nt) | opgH → | osmoregulated periplasmic glucans biosynthesis protein H |
| RA | 1,169,836 | A→G | L180P (CTG→CCG) | ldtC ← | L,D‑transpeptidase LdtC |
| RA | 1,189,980 | A→G | T156T (ACT→ACC) | phoP ← | DNA‑binding transcriptional dual regulator PhoP |
| RA | 1,194,922 | G→A | T10T (ACC→ACT) | rluE ← | 23S rRNA pseudouridine(2457) synthase |
| RA | 1,196,220 | C→T | H366H (CAC→CAT) | icd → | isocitrate dehydrogenase |
| RA | 1,196,232 | C→T | T370T (ACC→ACT) | icd → | isocitrate dehydrogenase |
| RA | 1,196,245 | T→C | L375M (TTA→CTG) | icd → | isocitrate dehydrogenase |
| RA | 1,196,247 | A→G | L375M (TTA→CTG) | icd → | isocitrate dehydrogenase |
| RA | 1,196,277 | C→T | N385N (AAC→AAT) | icd → | isocitrate dehydrogenase |
| RA | 1,196,280 | G→C | A386A (GCG→GCC) | icd → | isocitrate dehydrogenase |
| RA | 1,196,283 | A→G | K387K (AAA→AAG) | icd → | isocitrate dehydrogenase |
| RA | 1,196,292 | C→T | T390T (ACC→ACT) | icd → | isocitrate dehydrogenase |
| RA | 1,196,304 | G→A | E394E (GAG→GAA) | icd → | isocitrate dehydrogenase |
| RA | 1,196,325 | A→G | K401K (AAA→AAG) | icd → | isocitrate dehydrogenase |
| RA | 1,252,337 | G→T | K424N (AAG→AAT) | dhaR → | DNA‑binding transcriptional dual regulator DhaR |
| RA | 1,253,002 | C→T | intergenic (+17/+83) | dhaR → / ← ycgV | DNA‑binding transcriptional dual regulator DhaR/putative autotransporter adhesin YcgV |
| RA | 1,271,728 | Δ1 bp | coding (122/1101 nt) | chaA ← | Na(+)/K(+):H(+) antiporter ChaA |
| JC JC | 1,293,196 | IS5 (+) +4 bp | intergenic (‑274/‑328) | hns ← / → tdk | DNA‑binding transcriptional dual regulator H‑NS/thymidine/deoxyuridine kinase |
| MC JC | 1,299,499 | Δ1,199 bp | insH21 | insH21 | |
| RA | 1,301,992 | A→T | N271Y (AAT→TAT) | oppA → | oligopeptide ABC transporter periplasmic binding protein |
| RA | 1,306,736 | T→G | S325A (TCC→GCC) | oppF → | murein tripeptide ABC transporter/oligopeptide ABC transporter ATP binding subunit OppF |
| RA | 1,310,770 | A→G | H32H (CAT→CAC) | yciI ← | protein YciI |
| RA | 1,337,394 | A→G | S522G (AGC→GGC) | acnA → | aconitate hydratase 1 |
| RA | 1,357,202 | C→T | intergenic (‑92/+221) | sapA ← / ← ymjA | putative periplasmic binding protein SapA/DUF2543 domain‑containing protein YmjA |
| RA | 1,358,859 | T→C | Y110C (TAT→TGT) | puuP ← | putrescine:H(+) symporter PuuP |
| RA | 1,428,052 | T→C | G225G (GGA→GGG) | insH5 ← | IS5 family transposase and trans‑activator |
| RA | 1,428,097 | A→C | L210L (CTT→CTG) | insH5 ← | IS5 family transposase and trans‑activator |
| RA | 1,428,391 | G→C | L112L (CTC→CTG) | insH5 ← | IS5 family transposase and trans‑activator |
| RA | 1,428,424 | A→G | D101D (GAT→GAC) | insH5 ← | IS5 family transposase and trans‑activator |
| RA | 1,428,432 | G→A | L99L (CTG→TTG) | insH5 ← | IS5 family transposase and trans‑activator |
| RA | 1,428,451 | T→C | R92R (CGA→CGG) | insH5 ← | IS5 family transposase and trans‑activator |
| RA | 1,428,463 | G→A | R88R (CGC→CGT) | insH5 ← | IS5 family transposase and trans‑activator |
| RA | 1,428,487 | G→A | A80A (GCC→GCT) | insH5 ← | IS5 family transposase and trans‑activator |
| RA | 1,452,943 | C→A | A234S (GCG→TCG) | paaZ ← | fused 3‑oxo‑5,6‑dehydrosuberyl‑CoA semialdehyde dehydrogenase and oxepin‑CoA hydrolase |
| RA | 1,584,092 | G→A | intergenic (‑133/+115) | safA ← / ← ydeP | two‑component system connector SafA/putative oxidoreductase YdeP |
| JC JC | 1,590,536 | IS2 (+) +5 bp | intergenic (‑535/+314) | ydeT ← / ← hipA | fimbrial usher domain‑containing protein YdeT/serine/threonine‑protein kinase toxin HipA |
| RA | 1,612,881 | C→A | C124F (TGC→TTC) | glsB ← | glutaminase 2 |
| RA | 1,629,247 | C→T | I11I (ATC→ATT) | ydfZ → | putative selenoprotein YdfZ |
| RA | 1,642,112 | G→A | intergenic (+45/‑10) | cspF → / → ynfS | cold shock‑like protein CspF/protein YnfS |
| RA | 1,643,679 | A→T | L209Q (CTG→CAG) | ydfU ← | protein YdfU |
| RA | 1,652,331 | T→C | intergenic (+2346/+397) | ydfD → / ← ynfP | lysis protein/protein YnfP |
| RA | 1,667,460 | G→A | Q369* (CAG→TAG) | mlc ← | DNA‑binding transcriptional repressor Mlc |
| RA | 1,682,459 | A→G | K101E (AAA→GAA) | rstA → | DNA‑binding transcriptional regulator RstA |
| RA | 1,725,576 | C→A | M19I (ATG→ATT) | ydhF ← | putative oxidoreductase YdhF |
| RA | 1,726,528 | G→C | G169A (GGC→GCC) | nemR → | DNA‑binding transcriptional repressor NemR |
| RA | 1,748,841 | C→T | R240K (AGA→AAA) | ydhT ← | uncharacterized protein YdhT |
| RA | 1,767,014 | C→T | G558S (GGT→AGT) | ydiJ ← | putative FAD‑linked oxidoreductase YdiJ |
| JC JC | 1,803,431 | IS5 (–) +4 bp | intergenic (‑861/‑1731) | thrS ← / → yniD | threonine‑‑tRNA ligase/uncharacterized protein YniD |
| RA | 1,816,943 | T→C | T65A (ACT→GCT) | chbG ← | chitooligosaccharide monodeacetylase ChbG |
| RA | 1,848,300 | 2 bp→TT | coding (376‑377/552 nt) | ydjA ← | putative oxidoreductase YdjA |
| RA | 1,849,629 | T→C | L265L (TTA→CTA) | sppA → | protease IV, a signal peptide peptidase |
| RA | 1,894,839 | T→C | L12P (CTC→CCC) | pabB → | aminodeoxychorismate synthase subunit 1 |
| RA | 1,920,373 | G→T | A51S (GCT→TCT) | rsmF → | 16S rRNA m(5)C1407 methyltransferase |
| MC JC | 1,978,503 | Δ776 bp | insB5–insA5 | insB5, insA5 | |
| RA | 2,011,066 | A→G | N156S (AAT→AGT) | yedL → | putative acetyltransferase YedL |
| RA | 2,040,433 | C→A | A319D (GCC→GAC) | msrP → | protein‑L‑methionine sulfoxide reductase catalytic subunit MsrP |
| RA | 2,041,278 | G→A | intergenic (+160/‑97) | msrQ → / → zinT | membrane‑bound flavocytochrome MsrQ/metal‑binding protein ZinT |
| JC JC | 2,042,111 | IS5 (–) +4 bp | intergenic (+86/‑254) | zinT → / → yodB | metal‑binding protein ZinT/putative cytochrome b561 YodB |
| RA | 2,052,885 | G→A | intergenic (+871/‑758) | yeeJ → / → shiA | inverse autotransporter adhesin/shikimate:H(+) symporter |
| RA | 2,111,259 | Δ1 bp | coding (718/900 nt) | rfbD ← | dTDP‑4‑dehydrorhamnose reductase |
| RA | 2,126,929 | T→A | S88C (AGC→TGC) | fcl ← | GDP‑L‑fucose synthase |
| RA | 2,142,598 | G→A | L117L (CTC→CTT) | udk ← | uridine/cytidine kinase |
| RA | 2,155,197 | G→A | Q394Q (CAG→CAA) | mdtA → | multidrug efflux pump membrane fusion protein MdtA |
| RA | 2,172,897 | G→A | intergenic (‑24/+1385) | gatD ← / ← gatB | galactitol‑1‑phosphate 5‑dehydrogenase/galactitol‑specific PTS enzyme IIB component |
| RA | 2,173,363 | Δ2 bp | intergenic (‑490/+918) | gatD ← / ← gatB | galactitol‑1‑phosphate 5‑dehydrogenase/galactitol‑specific PTS enzyme IIB component |
| RA | 2,173,448 | C→T | intergenic (‑575/+834) | gatD ← / ← gatB | galactitol‑1‑phosphate 5‑dehydrogenase/galactitol‑specific PTS enzyme IIB component |
| JC JC | 2,176,844 | IS4 (–) +13 bp | coding (349‑361/855 nt) | gatY ← | tagatose‑1,6‑bisphosphate aldolase 2 |
| RA | 2,186,824 | G→T | intergenic (+83/‑136) | rcnA → / → rcnB | Ni(2(+))/Co(2(+)) exporter/periplasmic protein involved in nickel/cobalt export |
| RA | 2,233,609 | C→T | Q4* (CAG→TAG) | yeiS → | DUF2542 domain‑containing protein YeiS |
| JC JC | 2,238,948 | Δ1 bp :: IS186 (–) +6 bp :: Δ2 bp | coding (337‑342/1521 nt) | mglA ← | D‑galactose/methyl‑galactoside ABC transporter ATP binding subunit |
| RA | 2,242,247 | C→T | G241R (GGG→AGG) | yeiB ← | DUF418 domain‑containing protein YeiB |
| RA | 2,247,134 | A→C | Y467D (TAC→GAC) | lysP ← | lysine:H(+) symporter |
| RA | 2,307,733 | C→T | A295T (GCG→ACG) | yojI ← | ABC transporter family protein/microcin J25 efflux protein |
| RA | 2,310,878 | 2 bp→TT | coding (656‑657/1056 nt) | ftp ← | FAD:protein FMN transferase |
| RA | 2,316,059 | C→A | Q858K (CAG→AAG) | rcsD → | RcsD phosphotransferase |
| RA | 2,339,161 | T→C | D87G (GAC→GGC) | gyrA ← | DNA gyrase subunit A |
| RA | 2,404,402 | G→A | S71L (TCG→TTG) | nuoB ← | NADH:quinone oxidoreductase subunit B |
| RA | 2,405,990 | C→G | V218L (GTC→CTC) | lrhA ← | DNA‑binding transcriptional dual regulator LrhA |
| RA | 2,446,592 | C→A | P294P (CCG→CCT) | aroC ← | chorismate synthase |
| RA | 2,485,636 | Δ1 bp | coding (1263/3594 nt) | evgS → | sensor histidine kinase EvgS |
| RA | 2,485,638 | T→A | L422* (TTA→TAA) | evgS → | sensor histidine kinase EvgS |
| RA | 2,522,369 | G→A | P37S (CCG→TCG) | xapR ← | DNA‑binding transcriptional activator XapR |
| MC JC | 2,558,699 | Δ6,790 bp | intZ–[eutA] | intZ, yffL, yffM, yffN, yffO, yffP, yffQ, yffR, yffS, [eutA] | |
| RA | 2,587,112 | C→T | A461V (GCA→GTA) | narQ → | sensor histidine kinase NarQ |
| RA | 2,668,977 | C→T | intergenic (‑81/‑55) | hcaR ← / → hcaE | DNA‑binding transcriptional dual regulator HcaR/putative 3‑phenylpropionate/cinnamate dioxygenase subunit alpha |
| RA | 2,702,363 | G→A | A36V (GCC→GTC) | recO ← | recombination mediator protein RecO |
| RA | 2,741,296 | C→A | intergenic (‑146/‑64) | aroF ← / → yfiL | 3‑deoxy‑7‑phosphoheptulonate synthase, Tyr‑sensitive/DUF2799 domain‑containing lipoprotein YfiL |
| RA | 2,774,947 | G→A | G544S (GGT→AGT) | yfjW → | uncharacterized protein YfjW |
| RA | 2,804,133 | C→T | S211F (TCT→TTT) | nrdF → | ribonucleoside‑diphosphate reductase 2 subunit beta |
| RA | 2,814,459 | Δ1 bp | coding (275/516 nt) | luxS ← | S‑ribosylhomocysteine lyase |
| RA | 2,814,461 | C→T | L91L (CTG→CTA) | luxS ← | S‑ribosylhomocysteine lyase |
| RA | 2,817,197 | G→A | R103C (CGC→TGC) | yqaB ← | fructose‑1‑phosphate phosphatase YqaB |
| RA | 2,867,455 | G→A | Q33* (CAG→TAG) | rpoS ← | RNA polymerase sigma factor RpoS |
| RA | 2,871,153 | T→G | N51T (AAC→ACC) | truD ← | tRNA pseudouridine(13) synthase |
| RA | 2,880,635 | T→C | L138L (TTA→TTG) | casD ← | type I‑E CRISPR system Cascade subunit CasD |
| RA | 2,926,772 | C→A | G155G (GGC→GGA) | ppnN → | nucleotide 5'‑monophosphate nucleosidase |
| RA | 2,936,855 | T→G | A424A (GCT→GCG) | fucI → | L‑fucose isomerase |
| RA | 2,937,210 | C→T | L543F (CTC→TTC) | fucI → | L‑fucose isomerase |
| RA | 2,938,548 | A→T | T361S (ACG→TCG) | fucK → | L‑fuculokinase |
| RA | 2,968,501 | C→A | Q159H (CAG→CAT) | rppH ← | RNA pyrophosphohydrolase |
| RA | 3,025,601 | (T)5→4 | coding (1251/1401 nt) | xanQ → | xanthine:H(+) symporter XanQ |
| RA | 3,050,220 | G→T | P150T (CCG→ACG) | gcvT ← | aminomethyltransferase |
| RA | 3,070,858 | T→G | K129N (AAA→AAC) | fbaA ← | fructose‑bisphosphate aldolase class II |
| MC JC | 3,100,839 | Δ29,307 bp | IS5‑mediated | yggN–[yghO] | 26 genes yggN, yggL, trmB, mutY, yggX, mltC, nupG, speC, yqgH, yqgA, pheV, yghD, yghE, yqhJ, yghF, yghG, pppA, yghJ, glcA, glcB, glcG, glcF, glcE, glcD, glcC, [yghO] |
| RA | 3,207,549 | Δ1 bp | coding (179/606 nt) | ttdB → | L(+)‑tartrate dehydratase subunit beta |
| RA | 3,208,513 | G→T | G164W (GGG→TGG) | ttdT → | L‑tartrate:succinate antiporter |
| RA | 3,279,276 | C→G | F121L (TTC→TTG) | kbaZ → | putative tagatose‑1,6‑bisphosphate aldolase 1 chaperone |
| RA | 3,296,481 | G→A | V25M (GTG→ATG) | dolP → | division and outer membrane stress‑associated lipid‑binding lipoprotein |
| RA | 3,324,965 | G→T | intergenic (‑54/+36) | folP ← / ← ftsH | dihydropteroate synthase/ATP‑dependent zinc metalloprotease FtsH |
| RA | 3,326,537 | C→A | S133S (TCG→TCT) | ftsH ← | ATP‑dependent zinc metalloprotease FtsH |
| RA | 3,329,743 | G→T | D261Y (GAT→TAT) | dacB → | peptidoglycan DD‑endopeptidase DacB |
| RA | 3,388,041 | T→G | T50P (ACG→CCG) | aaeB ← | aromatic carboxylic acid efflux pump subunit AaeB |
| RA | 3,411,689 | G→T | E13* (GAA→TAA) | yhdJ → | DNA adenine methyltransferase |
| RA | 3,433,900 | C→T | L71L (CTA→TTA) | def → | peptide deformylase |
| RA | 3,439,485 | C→T | E9K (GAG→AAG) | yhdN ← | DUF1992 domain‑containing protein YhdN |
| RA | 3,441,528 | C→A | D50Y (GAC→TAC) | rpsD ← | 30S ribosomal subunit protein S4 |
| RA | 3,474,424 | T→G | K43N (AAA→AAC) | rpsL ← | 30S ribosomal subunit protein S12 |
| JC JC | 3,486,010 | IS2 (–) +5 bp :: Δ32 bp +GTCTTAATACTAGTTTTTAGACTATCACTTATTTAAGTGATATTGGTTGTCTGGAGATTCAGGGGGCCAGTCTA | intergenic (‑192/‑106) | yhfA ← / → crp | OsmC family protein YhfA/DNA‑binding transcriptional dual regulator CRP |
| RA | 3,486,502 | C→T | T128I (ACT→ATT) | crp → | DNA‑binding transcriptional dual regulator CRP |
| RA | 3,486,552 | G→A | A145T (GCA→ACA) | crp → | DNA‑binding transcriptional dual regulator CRP |
| RA | 3,511,466 | C→T | V293V (GTG→GTA) | yhfZ ← | putative DNA‑binding transcriptional regulator YhfZ |
| RA | 3,520,507 | G→A | P66L (CCC→CTC) | hofQ ← | DNA utilization protein HofQ |
| RA | 3,553,095 | C→A | P4Q (CCG→CAG) | malT → | DNA‑binding transcriptional activator MalT |
| RA | 3,555,047 | G→C | V655L (GTC→CTC) | malT → | DNA‑binding transcriptional activator MalT |
| RA | 3,560,362 | G→A | intergenic (+496/+260) | rtcR → / ← glpG | DNA‑binding transcriptional activator RtcR/rhomboid protease GlpG |
| RA | 3,560,455 | +G | intergenic (+589/+167) | rtcR → / ← glpG | DNA‑binding transcriptional activator RtcR/rhomboid protease GlpG |
| RA | 3,647,428 | C→T | A377V (GCG→GTG) | gor → | glutathione reductase (NADPH) |
| RA | 3,707,947 | C→A | intergenic (‑242/+669) | dppA ← / ← proK | dipeptide ABC transporter periplasmic binding protein/tRNA‑Pro |
| RA | 3,719,429 | G→A | intergenic (‑385/‑49) | yiaF ← / → yiaG | DUF3053 domain‑containing protein YiaF/putative DNA‑binding transcriptional regulator YiaG |
| RA | 3,725,176 | T→G | E48A (GAG→GCG) | glyQ ← | glycine‑‑tRNA ligase subunit alpha |
| RA | 3,729,440 | 2 bp→TT | noncoding (105‑106/160 nt) | xylZ ← | small RNA XylZ |
| RA | 3,730,560 | C→T | W69* (TGG→TAG) | xylA ← | xylose isomerase |
| RA | 3,770,539 | C→T | V281M (GTG→ATG) | yibH ← | inner membrane protein YibH |
| RA | 3,773,173 | Δ1 bp | coding (893/1914 nt) | mtlA → | mannitol‑specific PTS enzyme IICBA component |
| RA | 3,773,176 | C→T | S299F (TCT→TTT) | mtlA → | mannitol‑specific PTS enzyme IICBA component |
| RA | 3,815,883 | +C | coding (667/687 nt) | rph ← | truncated RNase PH |
| RA | 3,853,793 | G→T | G16G (GGC→GGA) | ysdE ← | protein YsdE |
| RA | 3,925,834 | C→T | intergenic (‑201/+178) | mnmG ← / ← mioC | 5‑carboxymethylaminomethyluridine‑tRNA synthase subunit MnmG/flavoprotein MioC |
| RA | 3,926,991 | G→A | L5L (CTG→TTG) | asnC ← | DNA‑binding transcriptional dual regulator AsnC |
| RA | 3,966,530 | 2 bp→TT | coding (114‑115/1260 nt) | rho → | transcription termination factor Rho |
| RA | 3,984,524 | G→T | T495K (ACA→AAA) | aslA ← | putative sulfatase AslA |
| JC JC | 4,000,721 | IS4 (–) +12 bp | coding (325‑336/765 nt) | yigE ← | DUF2233 domain‑containing protein YigE |
| RA | 4,003,502 | G→T | P226Q (CCG→CAG) | rarD ← | putative transporter RarD |
| RA | 4,091,682 | C→A | G229* (GGA→TGA) | frvB ← | putative PTS enzyme IIBC component FrvB |
| JC JC | 4,123,617 | IS2 (–) +5 bp | coding (836‑840/1026 nt) | cytR ← | DNA‑binding transcriptional repressor CytR |
| RA | 4,150,418 | A→G | intergenic (‑153/+29) | eptC ← / ← ppc | phosphoethanolamine transferase EptC/phosphoenolpyruvate carboxylase |
| RA | 4,193,996 | T→G | D70A (GAT→GCT) | thiE ← | thiamine phosphate synthase |
| RA | 4,217,310 | A→G | S68G (AGC→GGC) | aceA → | isocitrate lyase |
| RA | 4,223,638 | T→C | intergenic (‑10/‑190) | iclR ← / → metH | DNA‑binding transcriptional repressor IclR/cobalamin‑dependent methionine synthase |
| RA | 4,269,485 | G→A | L24L (CTG→CTA) | aphA → | acid phosphatase/phosphotransferase |
| RA | 4,296,381 | +GC | intergenic (+587/+55) | gltP → / ← yjcO | glutamate/aspartate : H(+) symporter GltP/Sel1 repeat‑containing protein YjcO |
| RA | 4,325,644 | C→T | S33N (AGC→AAC) | yjdN ← | PF06983 family protein YjdN |
| RA | 4,331,890 | C→T | L463L (CTC→CTT) | proP → | osmolyte:H(+) symporter ProP |
| RA | 4,437,890 | C→T | Q62* (CAG→TAG) | ytfI → | protein YtfI |
| RA | 4,473,900 | C→T | G52R (GGA→AGA) | bdcA ← | c‑di‑GMP‑binding biofilm dispersal mediator protein |
| RA | 4,475,493 | T→C | F19F (TTT→TTC) | yjgL → | protein YjgL |
| RA | 4,476,605 | G→A | S390N (AGC→AAC) | yjgL → | protein YjgL |
| RA | 4,489,016 | C→T | E350K (GAA→AAA) | yjgR ← | DUF853 domain‑containing protein YjgR |
| RA | 4,510,238 | T→G | intergenic (+445/+452) | insO → / ← fecE | IS911B regulator fragment/ferric citrate ABC transporter ATP binding subunit |
| RA | 4,532,409 | T→G | intergenic (‑758/+28) | sgcX ← / ← yjhP | putative endoglucanase with Zn‑dependent exopeptidase domain/putative methyltransferase YjhP |
| JC JC | 4,542,237 | IS1 (–) +9 bp | coding (201‑209/597 nt) | fimE → | regulator for fimA |
| RA | 4,546,601 | C→T | I502I (ATC→ATT) | fimD → | type I fimbriae usher protein |
| RA | 4,596,579 | C→A | A197E (GCG→GAG) | lgoD → | L‑galactonate oxidoreductase |
| RA | 4,631,800 | G→T | L356F (TTG→TTT) | slt → | soluble lytic murein transglycosylase |
| RA | 4,636,925 | G→C | R77P (CGC→CCC) | creC → | sensory histidine kinase CreC |
| RA | 4,638,240 | G→A | L21L (TTG→TTA) | creD → | putative inner membrane protein CreD |
| Unassigned missing coverage evidence | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| seq id | start | end | size | ←reads | reads→ | gene | description | |||
| * | * | ÷ | NC_000913 | 1196341 | 1211489 | 15149 | 6 [5] | [5] 6 | [icd]–mcrA | [icd],C0293,ymfD,ymfE,lit,intE,xisE,ymfH,ymfI,ymfJ,ymfK,ymfT,ymfL,ymfM,ymfN,ymfR,beeE,ymfQ,ycfK,tfaP,tfaE,pinE,mcrA |
| * | * | ÷ | NC_000913 | 1428148 | 1428385 | 238 | 6 [5] | [5] 6 | insH5 | IS5 family transposase and trans‑activator |
| * | * | ÷ | NC_000913 | 3423873–3424233 | 3424445–3424242 | 10–573 | 6 [5] | [5] 6 | [rrlD] | [rrlD] |
| * | * | ÷ | NC_000913 | 4035359–4035732 | 4036916–4035736 | 5–1558 | 6 [5] | [5] 6 | [rrsA] | [rrsA] |
| Unassigned new junction evidence | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
| * | ? | NC_000913 | = 256107 | 35 (1.480) | 19 (0.830) | 17/480 | 0.4 | 40.1% | coding (131/459 nt) | gpt | xanthine‑guanine phsophoribosyltransferase |
| ? | NC_000913 | 371382 = | 23 (1.010) | coding (144/867 nt) | mhpC | 2‑hydroxy‑6‑ketonona‑2,4‑dienedioate hydrolase | |||||
| * | ? | NC_000913 | 4542682 = | 10 (0.420) | 11 (0.480) | 11/478 | 1.1 | 51.6% | intergenic (+49/‑433) | fimE/fimA | regulator for fimA/type 1 fimbriae major subunit |
| ? | NC_000913 | 4542996 = | 11 (0.480) | intergenic (+363/‑119) | fimE/fimA | regulator for fimA/type 1 fimbriae major subunit | |||||
| * | ? | NC_000913 | = 4542690 | 10 (0.420) | 11 (0.480) | 10/478 | 1.2 | 51.6% | intergenic (+57/‑425) | fimE/fimA | regulator for fimA/type 1 fimbriae major subunit |
| ? | NC_000913 | = 4542986 | 11 (0.480) | intergenic (+353/‑129) | fimE/fimA | regulator for fimA/type 1 fimbriae major subunit | |||||