Search All resources - result
Quick search All resources
Summary
| Resource Type | Hit Count |
|---|---|
| Gene Mutants | 136hits |
| Culture Condition | 1hits |
| ASKA Clone(-) | 1hits |
| ASKA Clone(+) | 1hits |
| Gateway Entry Clone library | 1hits |
| Mobile Plasmid Clone | 1hits |
| Cosmid Collection | 0hits |
| pLC Plasmid Collection | 0hits |
| Keio Collection | 1hits |
| Large-scale chromosomal deletion mutant (Tokyo Metropolitan University Group) | 0hits |
| NIG Wide Deletion Strain Collection (NEDO project) | 0hits |
| Transposon insertion disruptant | 1hits |
| Transposon insertion disruptant (cis partial doublet strain) | 0hits |
| Phage | 0hits |
| Cloning Vector Collection | 0hits |
| Cloning Vector CollectionHost Cell | 0hits |
| Antibody | 0hits |
Gene Mutants - List
Search Condition : (Keyword = deoB)
136hits
First Previous 1-10 11-20 21-30 31-40 41-50 51-60 Next Last All| ME No. | Strain Name | Sex | Genotype | Other Remarks | Gene Mutants Detail Info | Request |
|---|---|---|---|---|---|---|
| ME10091 | eCOMB | F- |
ΔthyA Δ(yjjG |
Recombinant status:non-recombinant
Phenotype:Requires thymidine BrdU pulse labeling possible in 1-4 minutes (56/2 synthetic medium, 50 μg/ml BrdU) |
Not available | |
| ME10092 | MTA220 | F- |
ΔthyA Δ(yjjG |
Recombinant status:non-recombinant
Phenotype:Requires thymidine Hi-C analysis is possible with thymidine-requiring strains. |
||
| ME10093 | MTA274 | F- |
ΔthyA Δ(yjjG |
Recombinant status:non-recombinant
Phenotype:Requires thymidine DNA polymerase III-ChIP analysis is possible in thymidine-requiring strains. References for holD-TAP-kan: Butland et al., Nature, 433, 531- 537, 2005. (DOI: 10.1038/nature03239) |
||
| ME9132 | AQ634 | F- |
trpA9 |
|
||
| ME9137 | AQ677 | F- |
trpA9 |
Possible Ls (Srm) strain: sensitive for rich media. Kogoma and Meyenburg., 1983, EMBO J., 2, 463-468. Ogawa et al., 1984, Proc. Natl. Acad. Sci. USA., 81, 1040-1044.
Further information: Kogoma T., 1997, Micrbiol. Mol. Biol. Rev., 61, 212-238. |
||
| ME9141 | AQ705 | F- |
metB1 dnaA4 |
|
||
| ME9195 | AQ1994 | F- |
trpA9 |
same as CM3440
Possible Ls (Srm) strain: sensitive for rich media. Kogoma and Meyenburg., 1983, EMBO J., 2, 463-468. Ogawa et al., 1984, Proc. Natl. Acad. Sci. USA., 81, 1040-1044. Further information: Kogoma T., 1997, Micrbiol. Mol. Biol. Rev., 61, 212-238. |
||
| ME9197 | AQ1997 | F- |
trpA9 |
same as CM3452
Possible Ls (Srm) strain: sensitive for rich media. Kogoma and Meyenburg., 1983, EMBO J., 2, 463-468. Ogawa et al., 1984, Proc. Natl. Acad. Sci. USA., 81, 1040-1044. Further information: Kogoma T., 1997, Micrbiol. Mol. Biol. Rev., 61, 212-238. |
||
| ME9235 | AQ2696 | F- |
trpA9 |
|
||
| ME9236 | AQ2781 | F- |
trpA9 |
|
Culture Condition - List
Search Condition : (Keyword = deoB)
1hits
First Previous 1-1 Next Last All| Gene Symbol | Mnemonic | Synonyms |
|---|---|---|
| deoB | deoxyribose | drm thyR tlr |
ASKA Clone(-) - List
Search Condition : (Keyword = deoB)
1hits
First Previous 1-1 Next Last All|
Resource No (JW ID)
|
Gene Name
|
Primer Sequence for N terminal | Primer Sequence for C terminal | Comment | Request |
|---|---|---|---|---|---|
| JW4346-AM | deoB | GCCAAACGTGCATTTATTATGGT | CCGAACATGGCTTTGCCATATTC | Clone OK |
ASKA Clone(+) - List
Search Condition : (Keyword = deoB)
1hits
First Previous 1-1 Next Last All|
Resource No (JW ID)
|
Gene Name
|
Primer Sequence for N terminal | Primer Sequence for C terminal | Comment | Request |
|---|---|---|---|---|---|
| JW4346-AP | deoB | GCCAAACGTGCATTTATTATGGT | CCGAACATGGCTTTGCCATATTC | Clone OK |
Gateway Entry Clone library - List
Search Condition : (Keyword = deoB)
1hits
First Previous 1-1 Next Last All|
Resource No (JW ID)
|
Gene Name
|
Clone verification class | Cloning Method | Request |
|---|---|---|---|---|
| JW4346-GE | deoB | B | ASKA to pDONR/zeo |
Mobile Plasmid Collection - List
Search Condition : (Keyword = deoB)
1hits
First Previous 1-1 Next Last All| Accession No | ORF No.(Japan) | ORF No.(USA) | Gene Name | Length | Source | Plasmid | Request |
|---|---|---|---|---|---|---|---|
| 4200 | 674#9 | b4383 | deoB | 1224 | pNTR-SD |
Keio Collection - List
Search Condition : (Keyword = deoB)
1hits
First Previous 1-1 Next Last All|
Resource No (JW ID)
|
Gene Name
|
Comment |
Cell Shape |
Cell Shape Image | Request |
|---|---|---|---|---|---|
| JW4346-KC | deoB | ready to distribute | Normal |
![]() |
Transposon insertion disruptant - List
Search Condition : (Keyword = deoB)
1hits
First Previous 1-1 Next Last All| Strain No | Insertion site (inserted after) |
MG1655 Gene name |
Request |
|---|---|---|---|
| JD25767 | 4617924 | deoB |





