Search All resources - result
Quick search All resources
Summary
| Resource Type | Hit Count |
|---|---|
| Gene Mutants | 186hits |
| Culture Condition | 1hits |
| ASKA Clone(-) | 1hits |
| ASKA Clone(+) | 1hits |
| Gateway Entry Clone library | 1hits |
| Mobile Plasmid Clone | 37hits |
| Cosmid Collection | 0hits |
| pLC Plasmid Collection | 6hits |
| Keio Collection | 1hits |
| Large-scale chromosomal deletion mutant (Tokyo Metropolitan University Group) | 31hits |
| NIG Wide Deletion Strain Collection (NEDO project) | 0hits |
| Transposon insertion disruptant | 2hits |
| Transposon insertion disruptant (cis partial doublet strain) | 0hits |
| Phage | 0hits |
| Cloning Vector Collection | 0hits |
| Cloning Vector CollectionHost Cell | 0hits |
| Antibody | 0hits |
Gene Mutants - List
Search Condition : (Keyword = trpE anth b1264 ECK1258 JW1256 tryD tryp-4)
186hits
First Previous 1-10 11-20 21-30 31-40 41-50 51-60 Next Last All| ME No. | Strain Name | Sex | Genotype | Other Remarks | Gene Mutants Detail Info | Request |
|---|---|---|---|---|---|---|
| ME8118 | CSH32 | F- | trpE thi |
|
||
| JE5713 | SP6male | Hfr |
rodA( |
(sup-126 trpE(Am) tyr(Am)) not tested
|
||
| JE5732 | #21 OV4 | F- |
rodA( |
CephaloridineS dacA+?(ponA sup-126 trpE(am) tyr(am)) not tested
|
||
| ME5437 | SH10 | F- | ilv trpE tonB tdk-1 tsx |
|
||
| ME8267 | LS5394 | F- |
trpA6 |
supplement 40_micro_g/ml Ade
|
||
| JE5827 | Dap-2 | F- |
thr trpE(Am) tyr(a |
Supplement 50_micro_g/ml DAP
|
||
| JE7439 | SP6 trAB#5 | F- |
sup-1 |
|
||
| JE7440 | SP6 trAB#6 | F- |
pfv sup-1 |
|
||
| JE5828 | his-3 | F- |
thr trpE(Am) tyr(a |
|
||
| ME8022 | JA200 | F+ | thr-1 leu-6 DE(trpE)5 recA lacY thi gal xyl ara mtl |
|
 Reference Genome: MG1655 (Accession No. NC_000913) |
Culture Condition - List
Search Condition : (Keyword = trpE anth b1264 ECK1258 JW1256 tryD tryp-4)
1hits
First Previous 1-1 Next Last All| Gene Symbol | Mnemonic | Synonyms |
|---|---|---|
| trpE | tryptophan | anth tryD tryo-4 |
ASKA Clone(-) - List
Search Condition : (Keyword = trpE anth b1264 ECK1258 JW1256 tryD tryp-4)
1hits
First Previous 1-1 Next Last All
Resource No (JW ID)
 |
Gene Name
|
Primer Sequence for N terminal | Primer Sequence for C terminal | Comment | Request |
|---|---|---|---|---|---|
| JW1256-AM | trpE | GCCCAAACACAAAAACCGACTCT | CCGAAAGTCTCCTGTGCATGATG | Clone OK |
ASKA Clone(+) - List
Search Condition : (Keyword = trpE anth b1264 ECK1258 JW1256 tryD tryp-4)
1hits
First Previous 1-1 Next Last All|
Resource No (JW ID)
|
Gene Name
|
Primer Sequence for N terminal | Primer Sequence for C terminal | Comment | Request |
|---|---|---|---|---|---|
| JW1256-AP | trpE | GCCCAAACACAAAAACCGACTCT | CCGAAAGTCTCCTGTGCATGATG | Clone OK |
Gateway Entry Clone library - List
Search Condition : (Keyword = trpE anth b1264 ECK1258 JW1256 tryD tryp-4)
1hits
First Previous 1-1 Next Last All|
Resource No (JW ID)
|
Gene Name
|
Clone verification class | Cloning Method | Request |
|---|---|---|---|---|
| JW1256-GE | trpE | A | ASKA to pDONR/zeo |
Mobile Plasmid Collection - List
Search Condition : (Keyword = trpE anth b1264 ECK1258 JW1256 tryD tryp-4)
37hits
First Previous 1-10 11-20 21-30 31-37 Next Last All| Accession No | ORF No.(Japan) | ORF No.(USA) | Gene Name | Length | Source | Plasmid | Request |
|---|---|---|---|---|---|---|---|
| 1216 | 253#3 | b1264 | trpE | 1563 | pNTR-SD | ||
| 4 | 101#4 | b0005 | 101#4 | 297 | pNTR-SD | ||
| 245 | 130#4 | b0263 | 130#4 | 363 | pNTR-SD | ||
| 510 | 159#4 | b0540 | 159#4 | 300 | USA | pNT3 | |
| 790 | 209#4 | b0834 | 209#4 | 1329 | pNT3 | ||
| 803 | 210#4 | b0845 | 210#4 | 1209 | pNTR-SD | ||
| 928 | 224#4 | b0971 | 224#4 | 177 | pNTR-SD | ||
| 985 | 230#4 | b1028 | 230#4 | 324 | pNT3 | ||
| 1127 | 243#4 | b1172 | 243#4 | 345 | Nara | pNT3 | |
| 1158 | 246#4 | b1202 | 246#4 | 2868 | pNTR-SD |
pLC Plasmid - List
Search Condition : (Keyword = trpE anth b1264 ECK1258 JW1256 tryD tryp-4)
6hits
First Previous 1-6 Next Last All| pLC Plasmid | Map Position(min)a | Kohara clones by hybridizedb and genesc | Request | |
|---|---|---|---|---|
| 19-19 | 19-19 | * | mrcB, fhuACDB(4 min) | |
| 3 | 11C5(115), 15A7(116), 9H2(117) | |||
| 4-43 | 4-43 | 75 | E4E4(618) | |
| * | mrcB, fhuACDB(4 min) | |||
| 4 | 15A7(116), 9H2(117), 4E4(118) | |||
| 4-44 | 4-44 | * | mrcB, fhuACDB(4 min) | |
| * | acrA(11 min) | |||
| 11 | 19B7(150), 8C4(151) | |||
| 26-43 | 26-43 | 5 | E2B8(121), 6F5(122), 10F9(123) | |
| * | pgsB, firA, acrC, sefA, dnaE(4 min) | |||
| 6-32 | 6-32 | 75 | E4E4(618) | |
| * | dapC, garB, mrcB, fhuACDB, popC, optA, dapD, glnD, cds, rpsB, tsf(4 min) | |||
| 4 | 15A7(116), 9H2(117), 4E4(118), 21C8(119), 12D5(120), E2B8(121) | |||
| 34-20 | 34-20 | 5 | E2B8(121), 6F5(122), 10F9(123) | |
| * | dnaE, tdi, pyrH, metD, proS, fadE, strC, rrnH, rrsH, alaV, ileV, rrlH, rrfH, aspU, dnaQ(4 min) |
Keio Collection - List
Search Condition : (Keyword = trpE anth b1264 ECK1258 JW1256 tryD tryp-4)
1hits
First Previous 1-1 Next Last All|
Resource No (JW ID)
|
Gene Name
|
Comment |
Cell Shape |
Cell Shape Image | Request |
|---|---|---|---|---|---|
| JW1256-KC | trpE | ready to distribute | Long |
 |
Large-scale chromosomal deletion mutant (Tokyo Metropolitan University Group) - List
Search Condition : (Keyword = trpE anth b1264 ECK1258 JW1256 tryD tryp-4)
31hits
First Previous 1-10 11-20 21-30 31-31 Next Last All| ME NO |
Deletion
|
Strain | System | plasmid(C-D) | Vector | Chromosomal Markers | Parent Recipient | Request |
|---|---|---|---|---|---|---|---|---|
| ME4576 | OCL05-4 | MG1655 red D(OCL5-4):Cm No.1 | red(SD3) | |||||
| ME4642 | OCL30-4 | MG1655 red D(OCL30-4):Cm No.1 | red(SD15) | |||||
| ME4649 | OCL34-4 | MG1655 red D(OCL35-4):Cm No.1 | red(SD14) | |||||
| ME4658 | OCL35-4 | MG1655 red D(OCL35-4):Cm No.1 | red(SD14) | |||||
| ME4673 | OCL41-4 | MG1655 red D(OCL41-4):Cm No.1 | red(SD10) | |||||
| ME4688 | OCL45-4 | MG1655 rh D(OCR8.9-1):Cm / mS-[Q (cytR-rpmE)] (Q / D187) No.2 | 664 | |||||
| ME4709 | OCL53-4 | MG1655 red D(OCL53-4):Cm No.1 | red(SD14) | |||||
| ME4747 | OCL64-4 | MG1655 red D(OCL64-4):Cm No.1 | red(SD14) | |||||
| ME4764 | OCL81-4 | MG1655 red D(OCL81-4):Cm No.1 | red(SD2) | |||||
| ME4781 | OCL88-4 | MG1655 red D(OCL88-4):Cm No.1 | red(SD15) |
