Search All resources - result
Quick search All resources
Summary
| Resource Type | Hit Count |
|---|---|
| Gene Mutants | 3hits |
| Culture Condition | 1hits |
| ASKA Clone(-) | 1hits |
| ASKA Clone(+) | 1hits |
| Gateway Entry Clone library | 1hits |
| Mobile Plasmid Clone | 1hits |
| Cosmid Collection | 0hits |
| pLC Plasmid Collection | 0hits |
| Keio Collection | 7hits |
| Large-scale chromosomal deletion mutant (Tokyo Metropolitan University Group) | 0hits |
| NIG Wide Deletion Strain Collection (NEDO project) | 0hits |
| Transposon insertion disruptant | 1hits |
| Transposon insertion disruptant (cis partial doublet strain) | 0hits |
| Phage | 0hits |
| Cloning Vector Collection | 0hits |
| Cloning Vector CollectionHost Cell | 1hits |
| Antibody | 0hits |
Gene Mutants - List
Search Condition : (Keyword = rpoS abrD appR b2741 csi2 dpeB ECK2736 JW5437 katF nur otsX sigS)
3hits
First Previous 1-3 Next Last All| ME No. | Strain Name | Sex | Genotype | Other Remarks | Gene Mutants Detail Info | Request |
|---|---|---|---|---|---|---|
| ME8300 | UM120 | Hfr |
thi katE1 |
|
||
| ME8301 | UM122 | Hfr |
thi katF1 |
|
||
| ME8302 | UM156 | F- |
leuB6 proC8 |
supplement 40_micro_g/ml Ade
|
Culture Condition - List
Search Condition : (Keyword = rpoS abrD appR b2741 csi2 dpeB ECK2736 JW5437 katF nur otsX sigS)
1hits
First Previous 1-1 Next Last All| Gene Symbol | Mnemonic | Synonyms |
|---|---|---|
| rpoS | RNA polymerase | abrD dpeB katF mur appR |
ASKA Clone(-) - List
Search Condition : (Keyword = rpoS abrD appR b2741 csi2 dpeB ECK2736 JW5437 katF nur otsX sigS)
1hits
First Previous 1-1 Next Last All
Resource No (JW ID)
 |
Gene Name
|
Primer Sequence for N terminal | Primer Sequence for C terminal | Comment | Request |
|---|---|---|---|---|---|
| JW5437-AM | rpoS | GCCGCCGAAGAGGAACTGTTATC | CCtTCGCGGAACAGCGCTTCGAT | Clone OK |
ASKA Clone(+) - List
Search Condition : (Keyword = rpoS abrD appR b2741 csi2 dpeB ECK2736 JW5437 katF nur otsX sigS)
1hits
First Previous 1-1 Next Last All|
Resource No (JW ID)
|
Gene Name
|
Primer Sequence for N terminal | Primer Sequence for C terminal | Comment | Request |
|---|---|---|---|---|---|
| JW5437-AP | rpoS | GCCGCCGAAGAGGAACTGTTATC | CCtTCGCGGAACAGCGCTTCGAT | Clone OK |
Gateway Entry Clone library - List
Search Condition : (Keyword = rpoS abrD appR b2741 csi2 dpeB ECK2736 JW5437 katF nur otsX sigS)
1hits
First Previous 1-1 Next Last All|
Resource No (JW ID)
|
Gene Name
|
Clone verification class | Cloning Method | Request |
|---|---|---|---|---|
| JW5437-GE | rpoS | A | ASKA to pDONR/zeo |
Mobile Plasmid Collection - List
Search Condition : (Keyword = rpoS abrD appR b2741 csi2 dpeB ECK2736 JW5437 katF nur otsX sigS)
1hits
First Previous 1-1 Next Last All| Accession No | ORF No.(Japan) | ORF No.(USA) | Gene Name | Length | Source | Plasmid | Request |
|---|---|---|---|---|---|---|---|
| 2630 | 451#1 | b2741 | rpoS | 993 | pNT3 |
Keio Collection - List
Search Condition : (Keyword = rpoS abrD appR b2741 csi2 dpeB ECK2736 JW5437 katF nur otsX sigS)
7hits
First Previous 1-7 Next Last All|
Resource No (JW ID)
|
Gene Name
|
Comment |
Cell Shape |
Cell Shape Image | Request |
|---|---|---|---|---|---|
| JW5437-KC | rpoS | ready to distribute | Normal |
 |
|
| JW2992-KC | ygiW | ready to distribute | Normal |
|
|
| JW1477-KC | osmC | ready to distribute | Normal |
|
|
| JW3415-KC | ugpC | ready to distribute | Normal |
|
|
| JW5516-KC | yqjC | ready to distribute | Normal |
|
|
| JW4130-KC | hfq | ready to distribute | Long |
|
|
| JW2889-KC | yggE | ready to distribute | Normal |
|
Transposon insertion disruptant - List
Search Condition : (Keyword = rpoS abrD appR b2741 csi2 dpeB ECK2736 JW5437 katF nur otsX sigS)
1hits
First Previous 1-1 Next Last All| Strain No | Insertion site (inserted after) |
MG1655 Gene name |
Request |
|---|---|---|---|
| JD23646 | 2865044 | rpoS |
Cloning Vector CollectionHost Cell -List
Search Condition : (Keyword = rpoS abrD appR b2741 csi2 dpeB ECK2736 JW5437 katF nur otsX sigS)
1hits
First Previous 1-1 Next Last All
