Search All resources - result
Quick search All resources
Summary
| Resource Type | Hit Count |
|---|---|
| Gene Mutants | 8hits |
| Culture Condition | 2hits |
| ASKA Clone(-) | 1hits |
| ASKA Clone(+) | 1hits |
| Gateway Entry Clone library | 1hits |
| Mobile Plasmid Clone | 1hits |
| Cosmid Collection | 0hits |
| pLC Plasmid Collection | 3hits |
| Keio Collection | 1hits |
| Large-scale chromosomal deletion mutant (Tokyo Metropolitan University Group) | 0hits |
| NIG Wide Deletion Strain Collection (NEDO project) | 0hits |
| Transposon insertion disruptant | 2hits |
| Transposon insertion disruptant (cis partial doublet strain) | 0hits |
| Phage | 0hits |
| Cloning Vector Collection | 0hits |
| Cloning Vector CollectionHost Cell | 0hits |
| Antibody | 0hits |
Gene Mutants - List
Search Condition : (Keyword = purC)
8hits
First Previous 1-8 Next Last All| ME No. | Strain Name | Sex | Genotype | Other Remarks | Gene Mutants Detail Info | Request |
|---|---|---|---|---|---|---|
| ME6079 | F- AroE | F- |
DE(pr |
|
||
| ME5476 | JC182-9 | Hfr | thi argR purC |
double male
|
||
| ME5370 | CU309, UTH4067 | F- | his tyrA trp purC guaA |
|
||
| ME5387 | EM3003 | F- | aroC purC lac thi str dsdA7 mal |
|
||
| JE6971 | Py22 | F- | thi argH mal str purC his |
|
||
| JE6973 | Py3 | F- | valS? thi mal str purC his |
|
||
| ME5383 | E726,H724 | F- | his tyrA trp purC guaB thi gal lac str |
|
 Reference Genome: MG1655 (Accession No. NC_000913) |
|
| JE6976 | Py37 | F- | ponBS980 valS? thr leu thi argH mal str purC his |
|
Culture Condition - List
Search Condition : (Keyword = purC)
2hits
First Previous 1-2 Next Last All| Gene Symbol | Mnemonic | Synonyms |
|---|---|---|
| purC | purine | adeg |
| purF | purine | adeub purC |
ASKA Clone(-) - List
Search Condition : (Keyword = purC)
1hits
First Previous 1-1 Next Last All
Resource No (JW ID)
 |
Gene Name
|
Primer Sequence for N terminal | Primer Sequence for C terminal | Comment | Request |
|---|---|---|---|---|---|
| JW2461-AM | purC | GCCCAAAAGCAAGCTGAGTTGTA | CCGTCCAGCTGTACACCCAGGCG | Clone OK |
ASKA Clone(+) - List
Search Condition : (Keyword = purC)
1hits
First Previous 1-1 Next Last All|
Resource No (JW ID)
|
Gene Name
|
Primer Sequence for N terminal | Primer Sequence for C terminal | Comment | Request |
|---|---|---|---|---|---|
| JW2461-AP | purC | GCCCAAAAGCAAGCTGAGTTGTA | CCGTCCAGCTGTACACCCAGGCG | Clone OK |
Gateway Entry Clone library - List
Search Condition : (Keyword = purC)
1hits
First Previous 1-1 Next Last All|
Resource No (JW ID)
|
Gene Name
|
Clone verification class | Cloning Method | Request |
|---|---|---|---|---|
| JW2461-GE | purC | A | ASKA to pDONR/zeo |
Mobile Plasmid Collection - List
Search Condition : (Keyword = purC)
1hits
First Previous 1-1 Next Last All| Accession No | ORF No.(Japan) | ORF No.(USA) | Gene Name | Length | Source | Plasmid | Request |
|---|---|---|---|---|---|---|---|
| 2377 | 424#1 | b2476 | purC | 714 | pNTR-SD |
pLC Plasmid - List
Search Condition : (Keyword = purC)
3hits
First Previous 1-3 Next Last All| pLC Plasmid | Map Position(min)a | Kohara clones by hybridizedb and genesc | Request | |
|---|---|---|---|---|
| 17-30 | 17-30 | * | dapA, purC,(53 min) | |
| 53 | 4C11(423), 5A8(424) | |||
| 43-32 | 43-32 | 53 | 4C11(423), 5A8(424) | |
| 73 | E1H9(628) | |||
| * | purC(53 min) | |||
| 25-14 | 25-14 | 53 | 4C11(423), 5A8(424), 10H6(425) | |
| 73 | E1H9(628) | |||
| * | purC(53 min) |
Keio Collection - List
Search Condition : (Keyword = purC)
1hits
First Previous 1-1 Next Last All|
Resource No (JW ID)
|
Gene Name
|
Comment |
Cell Shape |
Cell Shape Image | Request |
|---|---|---|---|---|---|
| JW2461-KC | purC | ready to distribute | Fat |
 |
