Search All resources - result
Quick search All resources
Summary
| Resource Type | Hit Count |
|---|---|
| Gene Mutants | 6hits |
| Culture Condition | 1hits |
| ASKA Clone(-) | 1hits |
| ASKA Clone(+) | 1hits |
| Gateway Entry Clone library | 1hits |
| Mobile Plasmid Clone | 1hits |
| Cosmid Collection | 0hits |
| pLC Plasmid Collection | 1hits |
| Keio Collection | 1hits |
| Large-scale chromosomal deletion mutant (Tokyo Metropolitan University Group) | 0hits |
| NIG Wide Deletion Strain Collection (NEDO project) | 0hits |
| Transposon insertion disruptant | 2hits |
| Transposon insertion disruptant (cis partial doublet strain) | 0hits |
| Phage | 0hits |
| Cloning Vector Collection | 0hits |
| Cloning Vector CollectionHost Cell | 0hits |
| Antibody | 0hits |
Gene Mutants - List
Search Condition : (Keyword = polB b0060 dinA ECK0061 JW0059)
6hits
First Previous 1-6 Next Last All| ME No. | Strain Name | Sex | Genotype | Other Remarks | Gene Mutants Detail Info | Request |
|---|---|---|---|---|---|---|
| ME9522 | AQ9232 | F- |
ara Δ(lac- |
same as SH2101
Further information: Kowalczykowski et al., 1994, Microbiol. Rev., 58, 401-465. Kogoma T., 1997, Micrbiol. Mol. Biol. Rev., 61, 212-238. |
||
| ME9524 | AQ9239 | F- |
ara Δ(lac- |
Further information: Kowalczykowski et al., 1994, Microbiol. Rev., 58, 401-465.
Lloyd R. G. and Brookslow K., Homologous recombination, p. 2236-2255. In Neidhaldt et al. (ed.), Escherichia coli and Salmonella: cellular and molecular biology, 2nd ed., American Society for Microbiolgy, Waschington, D. C. Kogoma T., 1997, Micrbiol. Mol. Biol. Rev., 61, 212-238. Further information: Kogoma T., 1997, Micrbiol. Mol. Biol. Rev., 61, 212-238. Further information: Kowalczykowski et al., 1994, Microbiol. Rev., 58, 401-465. Kogoma T., 1997, Micrbiol. Mol. Biol. Rev., 61, 212-238. Further information: Walker G. C., 1996, The SOS response of Escherichia coli, p. 1400-1416. In Neidhaldt et al. (ed.), Escherichia coli and Salmonella: cellular and molecular biology, 2nd ed., American Society for Microbiolgy, Waschington, D. C. Further information: Kogoma T., 1997, Micrbiol. Mol. Biol. Rev., 61, 212-238. Walker G. C., 1996, The SOS response of Escherichia coli, p. 1400-1416. In Neidhaldt et al. (ed.), Escherichia coli and Salmonella: cellular and molecular biology, 2nd ed., American Society for Microbiolgy, Waschington, D. C. |
||
| ME9601 | AQ10814 | F- |
trpA9 |
Further information: Kowalczykowski et al., 1994, Microbiol. Rev., 58, 401-465. Kogoma T., 1997, Micrbiol. Mol. Biol. Rev., 61, 212-238.
|
||
| ME9603 | AQ10838 | F- |
trpA9 |
Possible Ls (Srm) strain: sensitive for rich media. Kogoma and Meyenburg., 1983, EMBO J., 2, 463-468. Ogawa et al., 1984, Proc. Natl. Acad. Sci. USA., 81, 1040-1044.
Further information: Kowalczykowski et al., 1994, Microbiol. Rev., 58, 401-465. Kogoma T., 1997, Micrbiol. Mol. Biol. Rev., 61, 212-238. |
||
| ME10049 | YG5160 |
As TA153 |
Salmonella typhimurium
|
|||
| ME9526 | AQ9250 | F- |
metE9 |
Possible Ls (Srm) strain: sensitive for rich media. Kogoma and Meyenburg., 1983, EMBO J., 2, 463-468. Ogawa et al., 1984, Proc. Natl. Acad. Sci. USA., 81, 1040-1044.
Further information: Kogoma T., 1997, Micrbiol. Mol. Biol. Rev., 61, 212-238. Walker G. C., 1996, The SOS response of Escherichia coli, p. 1400-1416. In Neidhaldt et al. (ed.), Escherichia coli and Salmonella: cellular and molecular biology, 2nd ed., American Society for Microbiolgy, Waschington, D. C. |
Culture Condition - List
Search Condition : (Keyword = polB b0060 dinA ECK0061 JW0059)
1hits
First Previous 1-1 Next Last All| Gene Symbol | Mnemonic | Synonyms |
|---|---|---|
| polB | polymerase | dinA |
ASKA Clone(-) - List
Search Condition : (Keyword = polB b0060 dinA ECK0061 JW0059)
1hits
First Previous 1-1 Next Last All
Resource No (JW ID)
 |
Gene Name
|
Primer Sequence for N terminal | Primer Sequence for C terminal | Comment | Request |
|---|---|---|---|---|---|
| JW0059-AM | polB | GCCGCGCAGGCAGGTTTTATCTT | CCAAATAGCCCAAGTTGCCCGGT | Clone OK |
ASKA Clone(+) - List
Search Condition : (Keyword = polB b0060 dinA ECK0061 JW0059)
1hits
First Previous 1-1 Next Last All|
Resource No (JW ID)
|
Gene Name
|
Primer Sequence for N terminal | Primer Sequence for C terminal | Comment | Request |
|---|---|---|---|---|---|
| JW0059-AP | polB | GCCGCGCAGGCAGGTTTTATCTT | CCAAATAGCCCAAGTTGCCCGGT | Clone OK |
Gateway Entry Clone library - List
Search Condition : (Keyword = polB b0060 dinA ECK0061 JW0059)
1hits
First Previous 1-1 Next Last All|
Resource No (JW ID)
|
Gene Name
|
Clone verification class | Cloning Method | Request |
|---|---|---|---|---|
| JW0059-GE | polB | A | ASKA to pDONR/zeo |
Mobile Plasmid Collection - List
Search Condition : (Keyword = polB b0060 dinA ECK0061 JW0059)
1hits
First Previous 1-1 Next Last All| Accession No | ORF No.(Japan) | ORF No.(USA) | Gene Name | Length | Source | Plasmid | Request |
|---|---|---|---|---|---|---|---|
| 53 | 107#1 | b0060 | polB | 2352 | pNTR-SD |
pLC Plasmid - List
Search Condition : (Keyword = polB b0060 dinA ECK0061 JW0059)
1hits
First Previous 1-1 Next Last All| pLC Plasmid | Map Position(min)a | Kohara clones by hybridizedb and genesc | Request | |
|---|---|---|---|---|
| 26-6 | 26-6 | 2 | 6C1(109), 6F3(110), 15B8(111) | |
| * | leuA, ilvIH, mafB, serR, arl, polB, mraAB, pbpB, murE, murF(2 min) |
Keio Collection - List
Search Condition : (Keyword = polB b0060 dinA ECK0061 JW0059)
1hits
First Previous 1-1 Next Last All|
Resource No (JW ID)
|
Gene Name
|
Comment |
Cell Shape |
Cell Shape Image | Request |
|---|---|---|---|---|---|
| JW0059-KC | polB | ready to distribute | Normal |
 |
