Search All resources - result
Quick search All resources
Summary
| Resource Type | Hit Count |
|---|---|
| Gene Mutants | 6hits |
| Culture Condition | 1hits |
| ASKA Clone(-) | 1hits |
| ASKA Clone(+) | 1hits |
| Gateway Entry Clone library | 1hits |
| Mobile Plasmid Clone | 1hits |
| Cosmid Collection | 0hits |
| pLC Plasmid Collection | 1hits |
| Keio Collection | 1hits |
| Large-scale chromosomal deletion mutant (Tokyo Metropolitan University Group) | 0hits |
| NIG Wide Deletion Strain Collection (NEDO project) | 0hits |
| Transposon insertion disruptant | 2hits |
| Transposon insertion disruptant (cis partial doublet strain) | 0hits |
| Phage | 0hits |
| Cloning Vector Collection | 0hits |
| Cloning Vector CollectionHost Cell | 0hits |
| Antibody | 0hits |
Gene Mutants - List
Search Condition : (Keyword = nadB b2574 ECK2572 JW2558 nic nicB)
6hits
First Previous 1-6 Next Last All| ME No. | Strain Name | Sex | Genotype | Other Remarks | Gene Mutants Detail Info | Request |
|---|---|---|---|---|---|---|
| ME7764 | W3899 | F- | nad |
nad(=nic)
|
||
| ME5383 | E726,H724 | F- | his tyrA trp purC guaB thi gal lac str |
|
 Reference Genome: MG1655 (Accession No. NC_000913) |
|
| ME8424 | BD1467 | Hfr |
thi relA1 tyrA: |
use strain name for publication
|
||
| ME8595 | BD1467 GlyA::Tn5 | Hfr |
thi relA1 ung-1 nadB tyrA: |
|
||
| ME8597 | BD1467 PurF::Tn5 | Hfr |
thi relA1 ung-1 nadB tyrA: |
|
||
| ME8596 | BD1467 DapA or E::Tn5 | Hfr |
thi relA1 ung-1 nadB tyrA: |
supplement 50_micro_g/ml DAP
|
Culture Condition - List
Search Condition : (Keyword = nadB b2574 ECK2572 JW2558 nic nicB)
1hits
First Previous 1-1 Next Last All| Gene Symbol | Mnemonic | Synonyms |
|---|---|---|
| nadB | nicotinamide adenine dinucleotide |
ASKA Clone(-) - List
Search Condition : (Keyword = nadB b2574 ECK2572 JW2558 nic nicB)
1hits
First Previous 1-1 Next Last All
Resource No (JW ID)
 |
Gene Name
|
Primer Sequence for N terminal | Primer Sequence for C terminal | Comment | Request |
|---|---|---|---|---|---|
| JW2558-AM | nadB | GCCAATACTCTCCCTGAACATTC | CCTCTGTTTATGTAATGATTGCC | Clone OK |
ASKA Clone(+) - List
Search Condition : (Keyword = nadB b2574 ECK2572 JW2558 nic nicB)
1hits
First Previous 1-1 Next Last All|
Resource No (JW ID)
|
Gene Name
|
Primer Sequence for N terminal | Primer Sequence for C terminal | Comment | Request |
|---|---|---|---|---|---|
| JW2558-AP | nadB | GCCAATACTCTCCCTGAACATTC | CCTCTGTTTATGTAATGATTGCC | Clone OK |
Gateway Entry Clone library - List
Search Condition : (Keyword = nadB b2574 ECK2572 JW2558 nic nicB)
1hits
First Previous 1-1 Next Last All|
Resource No (JW ID)
|
Gene Name
|
Clone verification class | Cloning Method | Request |
|---|---|---|---|---|
| JW2558-GE | nadB | B | ASKA to pDONR/zeo |
Mobile Plasmid Collection - List
Search Condition : (Keyword = nadB b2574 ECK2572 JW2558 nic nicB)
1hits
First Previous 1-1 Next Last All| Accession No | ORF No.(Japan) | ORF No.(USA) | Gene Name | Length | Source | Plasmid | Request |
|---|---|---|---|---|---|---|---|
| 2475 | 435#8 | b2574 | nadB | 1623 | pNT3 |
pLC Plasmid - List
Search Condition : (Keyword = nadB b2574 ECK2572 JW2558 nic nicB)
1hits
First Previous 1-1 Next Last All| pLC Plasmid | Map Position(min)a | Kohara clones by hybridizedb and genesc | Request | |
|---|---|---|---|---|
| 34-46 | 34-46 | 28 | 4F1(253), 13F9(254) | |
| 54 | 4A12(435), 3F10(436), 21D7(437) | |||
| 4 | 21C8(119) | |||
| 10 | 19F6(146) | |||
| 59 | 25D2(450) | |||
| * | nadB, trmC, ranA, ung, pss(56 min) |
Keio Collection - List
Search Condition : (Keyword = nadB b2574 ECK2572 JW2558 nic nicB)
1hits
First Previous 1-1 Next Last All|
Resource No (JW ID)
|
Gene Name
|
Comment |
Cell Shape |
Cell Shape Image | Request |
|---|---|---|---|---|---|
| JW2558-KC | nadB | ready to distribute | Normal |
 |
