Search All resources - result
Quick search All resources
Summary
| Resource Type | Hit Count |
|---|---|
| Gene Mutants | 14hits |
| Culture Condition | 3hits |
| ASKA Clone(-) | 1hits |
| ASKA Clone(+) | 1hits |
| Gateway Entry Clone library | 1hits |
| Mobile Plasmid Clone | 1hits |
| Cosmid Collection | 0hits |
| pLC Plasmid Collection | 0hits |
| Keio Collection | 1hits |
| Large-scale chromosomal deletion mutant (Tokyo Metropolitan University Group) | 0hits |
| NIG Wide Deletion Strain Collection (NEDO project) | 0hits |
| Transposon insertion disruptant | 2hits |
| Transposon insertion disruptant (cis partial doublet strain) | 0hits |
| Phage | 0hits |
| Cloning Vector Collection | 0hits |
| Cloning Vector CollectionHost Cell | 2hits |
| Antibody | 1hits |
Gene Mutants - List
Search Condition : (Keyword = lamB b4036 ECK4028 JW3996 malB malL)
14hits
First Previous 1-10 11-14 Next Last All| ME No. | Strain Name | Sex | Genotype | Other Remarks | Gene Mutants Detail Info | Request |
|---|---|---|---|---|---|---|
| JE5500 | A5 | F- | lpm his thi argE lacY galK mtl xyl tsx |
|
||
| ME8485 | BW6166,CGSC6761 | Hfr |
supE4 |
F is intefrated in malB.
|
||
| JE5827 | Dap-2 | F- |
thr trpE( |
Supplement 50_micro_g/ml DAP
|
||
| JE5829 | Dap-His-4 | F- |
thr trpE( |
|
||
| JE5828 | his-3 | F- |
thr trpE( |
|
||
| JE5596 | G6 | Hfr | malB his |
|
||
| ME8152 | CSH68 | Hfr | mtl met malB |
CSH68 = Hfr6
|
||
| JE5528 | G6 Lpm#7 | Hfr | lpm trp malB |
|
||
| JE5830 | Trp-3 nalA1 | Hfr | lpm malB lac nalA |
|
||
| ME8464 | MM310 | F- |
araD1 |
|
Culture Condition - List
Search Condition : (Keyword = lamB b4036 ECK4028 JW3996 malB malL)
3hits
First Previous 1-3 Next Last AllASKA Clone(-) - List
Search Condition : (Keyword = lamB b4036 ECK4028 JW3996 malB malL)
1hits
First Previous 1-1 Next Last All|
Resource No (JW ID)
|
Gene Name
|
Primer Sequence for N terminal | Primer Sequence for C terminal | Comment | Request |
|---|---|---|---|---|---|
| JW3996-AM | lamB | GCCATGATTACTCTGCGCAAACT | CCCCACCAGATTTCCATCTGGGC | Clone OK |
ASKA Clone(+) - List
Search Condition : (Keyword = lamB b4036 ECK4028 JW3996 malB malL)
1hits
First Previous 1-1 Next Last All|
Resource No (JW ID)
|
Gene Name
|
Primer Sequence for N terminal | Primer Sequence for C terminal | Comment | Request |
|---|---|---|---|---|---|
| JW3996-AP | lamB | GCCATGATTACTCTGCGCAAACT | CCCCACCAGATTTCCATCTGGGC | Clone OK |
Gateway Entry Clone library - List
Search Condition : (Keyword = lamB b4036 ECK4028 JW3996 malB malL)
1hits
First Previous 1-1 Next Last All|
Resource No (JW ID)
|
Gene Name
|
Clone verification class | Cloning Method | Request |
|---|---|---|---|---|
| JW3996-GE | lamB | A | ASKA to pDONR/zeo |
Mobile Plasmid Collection - List
Search Condition : (Keyword = lamB b4036 ECK4028 JW3996 malB malL)
1hits
First Previous 1-1 Next Last All| Accession No | ORF No.(Japan) | ORF No.(USA) | Gene Name | Length | Source | Plasmid | Request |
|---|---|---|---|---|---|---|---|
| 3866 | 635#1 | b4036 | lamB | 1341 | pNTR-SD |
Keio Collection - List
Search Condition : (Keyword = lamB b4036 ECK4028 JW3996 malB malL)
1hits
First Previous 1-1 Next Last All|
Resource No (JW ID)
|
Gene Name
|
Comment |
Cell Shape |
Cell Shape Image | Request |
|---|---|---|---|---|---|
| JW3996-KC | lamB | ready to distribute | Normal |
![]() |
Transposon insertion disruptant - List
Search Condition : (Keyword = lamB b4036 ECK4028 JW3996 malB malL)
2hits
First Previous 1-2 Next Last AllCloning Vector CollectionHost Cell -List
Search Condition : (Keyword = lamB b4036 ECK4028 JW3996 malB malL)
2hits
First Previous 1-2 Next Last AllAntibody Collection - List
Search Condition : (Keyword = lamB b4036 ECK4028 JW3996 malB malL)
1hits
First Previous 1-1 Next Last All| Name | Name | Host | Polyclonal or Monoclonal | Antigen | Purification of Antiserum | Image (Whole Cell Western Blotting) | Stock Status | Volume(μl) | Request | Request | |
|---|---|---|---|---|---|---|---|---|---|---|---|
| Dilution Rate | Link | ||||||||||
| anti-LamB | anti-LamB | rabbit | Polyclonal | His6-LamB of E.coli | 50% Ammonium sulfate precipitation | 1/10,000 |
![]() |
in stock | 50 | ||







