Search All resources - result
Quick search All resources
Summary
| Resource Type | Hit Count |
|---|---|
| Gene Mutants | 139hits |
| Culture Condition | 2hits |
| ASKA Clone(-) | 1hits |
| ASKA Clone(+) | 1hits |
| Gateway Entry Clone library | 0hits |
| Mobile Plasmid Clone | 0hits |
| Cosmid Collection | 0hits |
| pLC Plasmid Collection | 0hits |
| Keio Collection | 0hits |
| Large-scale chromosomal deletion mutant (Tokyo Metropolitan University Group) | 0hits |
| NIG Wide Deletion Strain Collection (NEDO project) | 0hits |
| Transposon insertion disruptant | 0hits |
| Transposon insertion disruptant (cis partial doublet strain) | 0hits |
| Phage | 0hits |
| Cloning Vector Collection | 51hits |
| Cloning Vector CollectionHost Cell | 9hits |
| Antibody | 0hits |
Gene Mutants - List
Search Condition : (Keyword = lacZ)
139hits
First Previous 1-10 11-20 21-30 31-40 41-50 51-60 Next Last All| ME No. | Strain Name | Sex | Genotype | Other Remarks | Gene Mutants Detail Info | Request |
|---|---|---|---|---|---|---|
| ME9542 | AQ9504 | F- |
trpA9 |
Further information: Walker G. C., 1996, The SOS response of Escherichia coli, p. 1400-1416. In Neidhaldt et al. (ed.), Escherichia coli and Salmonella: cellular and molecular biology, 2nd ed., American Society for Microbiolgy, Waschington, D. C.
|
||
| ME7948 | KY1601; MC4100 DrpoH | F- |
ΔrpoH3 |
Unable to grow at or above 30C
|
||
| ME7949 | KY1612; MC4100 DrpoH::kan | F- |
ΔrpoH3 |
Unable to grow at or above 30C
|
||
| ME7930 | KY1429[λpF13-(PrpoDhs-lacZ)] | F- |
rpoH6 |
Unable to grow at high temperature (42C)
|
 Reference Genome: MG1655 (Accession No. NC_000913) |
|
| ME7931 | KY1429 [λpF13-(PgroE-lacZ)] | F- |
rpoH6 |
Unable to grow at high temperature (42C)
|
||
| ME7933 | KY1430[λpF13-(PrpoDhs-lacZ)] | F- |
rpoH1 |
Unable to grow at high temperature (42C)
|
||
| ME7934 | KY1430 [(λpF13-(PgroE-lacZ)] | F- |
rpoH1 |
Unable to grow at high temperature (42C)
|
||
| ME7936 | KY1431[λpF13-(PrpoDhs-lacZ)] | F- |
rpoH1 |
Unable to grow at high temperature (42C)
|
||
| ME7937 | KY1431[λpF13-(PgroE-lacZ)] | F- |
rpoH1 |
Unable to grow at high temperature (42C)
|
||
| ME7940 | KY1432[λpF13-(PgroE-lacZ)] | F- |
rpoH1 |
Unable to grow at high temperature (42C)
|
Culture Condition - List
Search Condition : (Keyword = lacZ)
2hits
First Previous 1-2 Next Last All| Gene Symbol | Mnemonic | Synonyms |
|---|---|---|
| lacZ | lactose | |
| lacY | lactose |
ASKA Clone(-) - List
Search Condition : (Keyword = lacZ)
1hits
First Previous 1-1 Next Last All
Resource No (JW ID)
 |
Gene Name
|
Primer Sequence for N terminal | Primer Sequence for C terminal | Comment | Request |
|---|---|---|---|---|---|
| JW0335-AM | lacZ | GCCACCATGATTACGGATTCACT | CCTTTTTGACACCAGACCAACTG | Clone OK |
ASKA Clone(+) - List
Search Condition : (Keyword = lacZ)
1hits
First Previous 1-1 Next Last All|
Resource No (JW ID)
|
Gene Name
|
Primer Sequence for N terminal | Primer Sequence for C terminal | Comment | Request |
|---|---|---|---|---|---|
| JW0335-AP | lacZ | GCCACCATGATTACGGATTCACT | CCTTTTTGACACCAGACCAACTG | Clone OK |
Cloning Vector Collection - List
Search Condition : (Keyword = lacZ)
51hits
First Previous 1-10 11-20 21-30 31-40 41-50 51-51 Next Last All| Name | Replicon | Size | Purpose | Selectable Markers | Map | Sequence | Request |
|---|---|---|---|---|---|---|---|
| pAB1001 | pMB1 | 5.965 | Portable Gene | amp | pAB1001 Map.png | pAB1001_assembly.fasta | |
| pAB1002 | pMB1 | 5.973 | Portable Gene | amp | pAB1002 Map.png | pAB1002_assembly.fasta | |
| pAB2001 | pMB1 | 6.91 | Portable Gene | amp, gen | pAB2001 Map.png | pAB2001_assembly.fasta | |
| pAB2002 | pMB1 | 6.937 | Portable Gene | amp, gen | pAB2002 Map.png | pAB2002_assembly.fasta | |
| pHRP308 | RSF1010 | 12.46 | Broad Host Range | gen | pHRP308 Map.png | pHRP308_assembly.fasta | |
| pHRP309 | RSF1010 | 12.46 | Promoter-cloning | gen | pHRP309 Map.png | pHRP309_assembly.fasta | |
| pHRP311 | RSF1010 | 14.0 | Broad Host Range | gen, spc/str | pHRP311_hybrid Map.png | pHRP311_hybrid .fasta | |
| pMC1871 | pMB1 | 7.478 | Portable Gene | tet | pMC1871 Map.png | Accession No. L08936 | |
| pBRINT-Cm | pMB1 | 5.28 | Integration into Host Chromosome | amp, cml | pBRINT-Cm Map.png | pBRINT-Cm_assembly.fasta | |
| pBRINT-Gm | pMB1 | 5.119 | Integration into Host Chromosome | amp, gen | pBRINT-Gm Map.png | pBRINT-Gm_assembly.fasta |
Cloning Vector CollectionHost Cell -List
Search Condition : (Keyword = lacZ)
9hits
First Previous 1-9 Next Last All| CV No. | Name | Genotype | Request |
|---|---|---|---|
| CV-20 | CB454 | F-, del(lacZ), galK, rpsL, thi, recA56 | |
| CV-21 | CB806 | F-, del(lacZ), galK, rpsL, thi, recA56, phoA8 | |
| CV-16 | CAG597 | rpoH(am)165, zhg::Tn10, lacZ(am), trp(am), pho(am),supCts, mal(am), rpsL | |
| CV-17 | CAG626 | lon, lacZ(am), trp(am), pho(am), supCts, mal(am),rpsL | |
| CV-18 | CAG629 | lon, rpoH(am)165, zhg::Tn10, lacZ(am), trp(am), pho(am),supCts, mal(am), rpsL | |
| CV-12 | BW25141 | lacIq, rrnB3, del(lacZ)4787, hsdR514, DE(araBAD)567,DE(rhaBAD)568, del(phoBR)580, rhp-1, galU95, del(endA)9,uidA(delMluI)::pir(wt), recA1 | |
| CV-13 | BW25142 | lacIq, rrnB3, del(lacZ)4787, hsdR514, DE(araBAD)567,DE(rhaBAD)568, del(phoBR)580, rhp-1, galU95, del(endA)9,uidA(delMluI)::pir116, recA1 | |
| CV-11 | BW23838 | F-, lacIq, rrnB3, del(lacZ)4787, del(phoBR)580,del(creABCD)154, hsdR154, del(pta ackA hisQ hisP)TA3516, phn(EcoB),DE(araBAD)567, DE(rhaBAD)568, rph-1, rpoS396(am), uidA(delMluI)::pir(wt),del(endA)9, recD1014, recA1 | |
| CV-25 | DH5alpha | F-, deoR, endA1, gyrA96, hsdR17(rk-mk+), recA1, relA1,supE44, thi-1, del(lacZYA- argF)U169, (Phi80lacZdelM15) |
