Search All resources - result
Quick search All resources
Summary
| Resource Type | Hit Count |
|---|---|
| Gene Mutants | 6hits |
| Culture Condition | 1hits |
| ASKA Clone(-) | 1hits |
| ASKA Clone(+) | 1hits |
| Gateway Entry Clone library | 1hits |
| Mobile Plasmid Clone | 1hits |
| Cosmid Collection | 0hits |
| pLC Plasmid Collection | 0hits |
| Keio Collection | 1hits |
| Large-scale chromosomal deletion mutant (Tokyo Metropolitan University Group) | 0hits |
| NIG Wide Deletion Strain Collection (NEDO project) | 0hits |
| Transposon insertion disruptant | 1hits |
| Transposon insertion disruptant (cis partial doublet strain) | 0hits |
| Phage | 0hits |
| Cloning Vector Collection | 0hits |
| Cloning Vector CollectionHost Cell | 0hits |
| Antibody | 0hits |
Gene Mutants - List
Search Condition : (Keyword = fadR b1187 dec ECK1175 JW1176 ole oleR thdB)
6hits
First Previous 1-6 Next Last All| ME No. | Strain Name | Sex | Genotype | Other Remarks | Gene Mutants Detail Info | Request |
|---|---|---|---|---|---|---|
| ME8293 | DC372 | F- |
srl:: |
srl::Tn10 is co-transduced with eno
|
||
| ME8377 | RS3338 | F- |
fadL7 |
|
||
| ME8292 | DC356 | F- |
zgb-6 |
Co-td ; fda pgk
|
||
| ME8394 | RS3263 | F+ |
fadR::Tn5 bef-1 |
|
||
| ME8267 | LS5394 | F- |
trpA6 |
supplement 40_micro_g/ml Ade
|
||
| ME8397 | LS5786 | F+ |
thi-1 metE6 |
|
Culture Condition - List
Search Condition : (Keyword = fadR b1187 dec ECK1175 JW1176 ole oleR thdB)
1hits
First Previous 1-1 Next Last All| Gene Symbol | Mnemonic | Synonyms |
|---|---|---|
| fadR | fatty acid and degradation | dec ole thdB |
ASKA Clone(-) - List
Search Condition : (Keyword = fadR b1187 dec ECK1175 JW1176 ole oleR thdB)
1hits
First Previous 1-1 Next Last All|
Resource No (JW ID)
|
Gene Name
|
Primer Sequence for N terminal | Primer Sequence for C terminal | Comment | Request |
|---|---|---|---|---|---|
| JW1176-AM | fadR | GCCGTCATTAAGGCGCAAAGCCC | CCTCGCCCCTGAATGGCTAAATC | Clone OK |
ASKA Clone(+) - List
Search Condition : (Keyword = fadR b1187 dec ECK1175 JW1176 ole oleR thdB)
1hits
First Previous 1-1 Next Last All|
Resource No (JW ID)
|
Gene Name
|
Primer Sequence for N terminal | Primer Sequence for C terminal | Comment | Request |
|---|---|---|---|---|---|
| JW1176-AP | fadR | GCCGTCATTAAGGCGCAAAGCCC | CCTCGCCCCTGAATGGCTAAATC | Clone OK |
Gateway Entry Clone library - List
Search Condition : (Keyword = fadR b1187 dec ECK1175 JW1176 ole oleR thdB)
1hits
First Previous 1-1 Next Last All|
Resource No (JW ID)
|
Gene Name
|
Clone verification class | Cloning Method | Request |
|---|---|---|---|---|
| JW1176-GE | fadR | A | ASKA to pDONR/zeo |
Mobile Plasmid Collection - List
Search Condition : (Keyword = fadR b1187 dec ECK1175 JW1176 ole oleR thdB)
1hits
First Previous 1-1 Next Last All| Accession No | ORF No.(Japan) | ORF No.(USA) | Gene Name | Length | Source | Plasmid | Request |
|---|---|---|---|---|---|---|---|
| 1143 | 244#7 | b1187 | fadR | 720 | pNTR-SD |
Keio Collection - List
Search Condition : (Keyword = fadR b1187 dec ECK1175 JW1176 ole oleR thdB)
1hits
First Previous 1-1 Next Last All|
Resource No (JW ID)
|
Gene Name
|
Comment |
Cell Shape |
Cell Shape Image | Request |
|---|---|---|---|---|---|
| JW1176-KC | fadR | ready to distribute | Normal |
![]() |
Transposon insertion disruptant - List
Search Condition : (Keyword = fadR b1187 dec ECK1175 JW1176 ole oleR thdB)
1hits
First Previous 1-1 Next Last All| Strain No | Insertion site (inserted after) |
MG1655 Gene name |
Request |
|---|---|---|---|
| JD22272 | 1234255 | fadR |





