Search All resources - result
Quick search All resources
Summary
| Resource Type | Hit Count |
|---|---|
| Gene Mutants | 2hits |
| Culture Condition | 3hits |
| ASKA Clone(-) | 1hits |
| ASKA Clone(+) | 1hits |
| Gateway Entry Clone library | 1hits |
| Mobile Plasmid Clone | 1hits |
| Cosmid Collection | 0hits |
| pLC Plasmid Collection | 2hits |
| Keio Collection | 1hits |
| Large-scale chromosomal deletion mutant (Tokyo Metropolitan University Group) | 0hits |
| NIG Wide Deletion Strain Collection (NEDO project) | 0hits |
| Transposon insertion disruptant | 0hits |
| Transposon insertion disruptant (cis partial doublet strain) | 2hits |
| Phage | 0hits |
| Cloning Vector Collection | 0hits |
| Cloning Vector CollectionHost Cell | 1hits |
| Antibody | 0hits |
Gene Mutants - List
Search Condition : (Keyword = dnaK b0014 ECK0014 groPAB groPC groPF grpC grpF JW0013 seg)
2hits
First Previous 1-2 Next Last All| ME No. | Strain Name | Sex | Genotype | Other Remarks | Gene Mutants Detail Info | Request |
|---|---|---|---|---|---|---|
| JE8498 | K1702 | F- |
grpC1 |
grpC170(= dnaK): a little leaky Ts thr- -> thr+
|
||
| ME7964 | NRK156 | F- |
dnaK7 |
Unable to grow at high temperature (42C)
|
Culture Condition - List
Search Condition : (Keyword = dnaK b0014 ECK0014 groPAB groPC groPF grpC grpF JW0013 seg)
3hits
First Previous 1-3 Next Last AllASKA Clone(-) - List
Search Condition : (Keyword = dnaK b0014 ECK0014 groPAB groPC groPF grpC grpF JW0013 seg)
1hits
First Previous 1-1 Next Last All
Resource No (JW ID)
 |
Gene Name
|
Primer Sequence for N terminal | Primer Sequence for C terminal | Comment | Request |
|---|---|---|---|---|---|
| JW0013-AM | dnaK | GCCGGTAAAATAATTGGTATCGA | CCTTTTTTGTCTTTGACTTCTTC | Clone OK |
ASKA Clone(+) - List
Search Condition : (Keyword = dnaK b0014 ECK0014 groPAB groPC groPF grpC grpF JW0013 seg)
1hits
First Previous 1-1 Next Last All|
Resource No (JW ID)
|
Gene Name
|
Primer Sequence for N terminal | Primer Sequence for C terminal | Comment | Request |
|---|---|---|---|---|---|
| JW0013-AP | dnaK | GCCGGTAAAATAATTGGTATCGA | CCTTTTTTGTCTTTGACTTCTTC | Clone OK |
Gateway Entry Clone library - List
Search Condition : (Keyword = dnaK b0014 ECK0014 groPAB groPC groPF grpC grpF JW0013 seg)
1hits
First Previous 1-1 Next Last All|
Resource No (JW ID)
|
Gene Name
|
Clone verification class | Cloning Method | Request |
|---|---|---|---|---|
| JW0013-GE | dnaK | A | ASKA to pDONR/zeo |
Mobile Plasmid Collection - List
Search Condition : (Keyword = dnaK b0014 ECK0014 groPAB groPC groPF grpC grpF JW0013 seg)
1hits
First Previous 1-1 Next Last All| Accession No | ORF No.(Japan) | ORF No.(USA) | Gene Name | Length | Source | Plasmid | Request |
|---|---|---|---|---|---|---|---|
| 12 | 102#5 | b0014 | dnaK | 1917 | pNTR-SD |
pLC Plasmid - List
Search Condition : (Keyword = dnaK b0014 ECK0014 groPAB groPC groPF grpC grpF JW0013 seg)
2hits
First Previous 1-2 Next Last All| pLC Plasmid | Map Position(min)a | Kohara clones by hybridizedb and genesc | Request | |
|---|---|---|---|---|
| 17-22 | 17-22 | * | phoM, cet, dye, fexA, msp, seg, sfrA, thr(100min) | |
| 100 | 12A4(675), 15A5(676), 9E4(101) | |||
| 35-1 | 35-1 | 55 | 7F8(429), 5E10(430) | |
| 28 | 14C4(252), 4F1(253) | |||
| * | trpR, phoM, cet, dye, fexA, msp, seg, sfrA, thr(100 min) |
Keio Collection - List
Search Condition : (Keyword = dnaK b0014 ECK0014 groPAB groPC groPF grpC grpF JW0013 seg)
1hits
First Previous 1-1 Next Last All|
Resource No (JW ID)
|
Gene Name
|
Comment |
Cell Shape |
Cell Shape Image | Request |
|---|---|---|---|---|---|
| JW0013-KC | dnaK | ready to distribute | Long |
 |
Transposon insertion disruptant (cis partial doublet strain) - List
Search Condition : (Keyword = dnaK b0014 ECK0014 groPAB groPC groPF grpC grpF JW0013 seg)
2hits
First Previous 1-2 Next Last All
