Search All resources - result
Quick search All resources
Summary
| Resource Type | Hit Count |
|---|---|
| Gene Mutants | 15hits |
| Culture Condition | 0hits |
| ASKA Clone(-) | 2hits |
| ASKA Clone(+) | 2hits |
| Gateway Entry Clone library | 2hits |
| Mobile Plasmid Clone | 2hits |
| Cosmid Collection | 0hits |
| pLC Plasmid Collection | 1hits |
| Keio Collection | 2hits |
| Large-scale chromosomal deletion mutant (Tokyo Metropolitan University Group) | 1hits |
| NIG Wide Deletion Strain Collection (NEDO project) | 0hits |
| Transposon insertion disruptant | 5hits |
| Transposon insertion disruptant (cis partial doublet strain) | 0hits |
| Phage | 0hits |
| Cloning Vector Collection | 0hits |
| Cloning Vector CollectionHost Cell | 0hits |
| Antibody | 0hits |
Gene Mutants - List
Search Condition : (Keyword = glpB b2242 ECK2234 glpC JW2236 psi-51)
15hits
First Previous 1-10 11-15 Next Last All| ME No. | Strain Name | Sex | Genotype | Other Remarks | Gene Mutants Detail Info | Request |
|---|---|---|---|---|---|---|
| ME8820 | CAG18486 | F- |
eda-51::Tn1 |
Plaque forming activity against MG1655 was detected from culture supernatant of some strains of CAG series possibly caused by lysogenized phage.
Please be careful before using this strain. |
||
| ME9386 | AQ7946 | F- |
ruvC5 |
same as TNM554: Sharples et al., 1990, Mol. Gen. Genet., 221, 219-226.
Further information: Kowalczykowski et al., 1994, Microbiol. Rev., 58, 401-465. Lloyd R. G. and Brookslow K., Homologous recombination, p. 2236-2255. In Neidhaldt et al. (ed.), Escherichia coli and Salmonella: cellular and molecular biology, 2nd ed., American Society for Microbiolgy, Waschington, D. C. |
||
| ME5433 | RE103 | F- |
proA2 |
CM : 6_micro_g/ml : + 10_micro_g/ml : -
|
||
| ME8603 | RE103 | F- |
proA2 |
strA101 = rpsL101
|
||
| ME8743 | D23 | F- |
envB1 sloB1 his-51 trp-3 |
|
||
| JE8480 | DM1187 | F- |
his-4 strA3 |
|
||
| ME9420 | AQ8198 | F- |
pro Δ(pro- |
Further information: Kowalczykowski et al., 1994, Microbiol. Rev., 58, 401-465.
Lloyd R. G. and Brookslow K., Homologous recombination, p. 2236-2255. In Neidhaldt et al. (ed.), Escherichia coli and Salmonella: cellular and molecular biology, 2nd ed., American Society for Microbiolgy, Waschington, D. C. Walker G. C., 1996, The SOS response of Escherichia coli, p. 1400-1416. In Neidhaldt et al. (ed.), Escherichia coli and Salmonella: cellular and molecular biology, 2nd ed., American Society for Microbiolgy, Waschington, D. C. |
||
| ME9431 | AQ8368 | F- |
pro Δ(pro- |
Possible Ls (Srm) strain: sensitive for rich media. Kogoma and Meyenburg., 1983, EMBO J., 2, 463-468. Ogawa et al., 1984, Proc. Natl. Acad. Sci. USA., 81, 1040-1044.
Further information: Kogoma T., 1997, Micrbiol. Mol. Biol. Rev., 61, 212-238. Walker G. C., 1996, The SOS response of Escherichia coli, p. 1400-1416. In Neidhaldt et al. (ed.), Escherichia coli and Salmonella: cellular and molecular biology, 2nd ed., American Society for Microbiolgy, Waschington, D. C. |
||
| ME9396 | AQ8024 | F- |
trpA9 |
Ls: Srm phenotype, sensitivity for rich media. Ref: Kogoma and Meyenburg., 1983, EMBO J., 2, 463-468. Ogawa et al., 1984, Proc. Natl. Acad. Sci. USA., 81, 1040-1044.
Further information: Kowalczykowski et al., 1994, Microbiol. Rev., 58, 401-465. Lloyd R. G. and Brookslow K., Homologous recombination, p. 2236-2255. In Neidhaldt et al. (ed.), Escherichia coli and Salmonella: cellular and molecular biology, 2nd ed., American Society for Microbiolgy, Waschington, D. C. Kogoma T., 1997, Micrbiol. Mol. Biol. Rev., 61, 212-238. |
||
| ME8578 | CS101 | F- |
recA2 |
|
ASKA Clone(-) - List
Search Condition : (Keyword = glpB b2242 ECK2234 glpC JW2236 psi-51)
2hits
First Previous 1-2 Next Last All
Resource No (JW ID)
 |
Gene Name
|
Primer Sequence for N terminal | Primer Sequence for C terminal | Comment | Request |
|---|---|---|---|---|---|
| JW2236-AM | glpB | GCCCGCTTTGATACTGTCATTAT | CCTTGTTGaCCTCCTGCGCGTTGGGCAATC | Clone OK | |
| JW2237-AM | glpC | GCCAATGACACCAGCTTCGAAAA | CCAGCCAGCGCCTGGGCCAGTAG | Clone OK |
ASKA Clone(+) - List
Search Condition : (Keyword = glpB b2242 ECK2234 glpC JW2236 psi-51)
2hits
First Previous 1-2 Next Last All|
Resource No (JW ID)
|
Gene Name
|
Primer Sequence for N terminal | Primer Sequence for C terminal | Comment | Request |
|---|---|---|---|---|---|
| JW2236-AP | glpB | GCCCGCTTTGATACTGTCATTAT | CCTTGTTGaCCTCCTGCGCGTTGGGCAATC | Clone OK | |
| JW2237-AP | glpC | GCCAATGACACCAGCTTCGAAAA | CCAGCCAGCGCCTGGGCCAGTAG | Clone OK |
Gateway Entry Clone library - List
Search Condition : (Keyword = glpB b2242 ECK2234 glpC JW2236 psi-51)
2hits
First Previous 1-2 Next Last All|
Resource No (JW ID)
|
Gene Name
|
Clone verification class | Cloning Method | Request |
|---|---|---|---|---|
| JW2236-GE | glpB | C | ASKA to pDONR/zeo | |
| JW2237-GE | glpC | A | ASKA to pDONR/zeo |
Mobile Plasmid Collection - List
Search Condition : (Keyword = glpB b2242 ECK2234 glpC JW2236 psi-51)
2hits
First Previous 1-2 Next Last All| Accession No | ORF No.(Japan) | ORF No.(USA) | Gene Name | Length | Source | Plasmid | Request |
|---|---|---|---|---|---|---|---|
| 2155 | 378#8 | b2242 | glpB | 1260 | pNTR-SD | ||
| 2156 | 378#9 | b2243 | glpC | 1191 | pNTR-SD |
pLC Plasmid - List
Search Condition : (Keyword = glpB b2242 ECK2234 glpC JW2236 psi-51)
1hits
First Previous 1-1 Next Last All| pLC Plasmid | Map Position(min)a | Kohara clones by hybridizedb and genesc | Request | |
|---|---|---|---|---|
| 26-5 | 26-5 | 51 | 2C9(409), 6F7(410), 3A11(411) | |
| * | fadL(51 min) |
Keio Collection - List
Search Condition : (Keyword = glpB b2242 ECK2234 glpC JW2236 psi-51)
2hits
First Previous 1-2 Next Last All
Large-scale chromosomal deletion mutant (Tokyo Metropolitan University Group) - List
Search Condition : (Keyword = glpB b2242 ECK2234 glpC JW2236 psi-51)
1hits
First Previous 1-1 Next Last All| ME NO |
Deletion
|
Strain | System | plasmid(C-D) | Vector | Chromosomal Markers | Parent Recipient | Request |
|---|---|---|---|---|---|---|---|---|
| ME4559 | OCR50,51-1 | MG1655 rsh3 D(OCR50.51-1):Cm / p(ftsK) (AD / D140) No.3 | SD2-D140 | p(ftsK) | mFCm4 (KmR CmS) |
Transposon insertion disruptant - List
Search Condition : (Keyword = glpB b2242 ECK2234 glpC JW2236 psi-51)
5hits
First Previous 1-5 Next Last All
