ASKA Clone(-) - Detail

Resource No (JW ID) genobase.gif JW0031-AM
Gene Name  carB
Primer Sequence for N terminal GCCCCAAAACGTACAGATATAAA
Primer Sequence for C terminal CCTTTGATCTGTGCGTGCATTTC
Comment Clone OK
Reference
Request
page-top
/ecoli/strain