Notice: Suspension of Services Due to the Inspection work of NIG

For the inspection work of the institute, services on our website will be stopped during the period of time stated below. We apologize for the inconvenience and thank you for your understanding in this matter.

Fri. 12th Nov. 2021 16:00 - Sun. 14th Nov. 13:00 (JST)

ASKA Clone(+) - Detail

Resource No (JW ID) genobase.gif JW0031-AP
Gene Name  carB
Primer Sequence for N terminal GCCCCAAAACGTACAGATATAAA
Primer Sequence for C terminal CCTTTGATCTGTGCGTGCATTTC
Comment Clone OK