Search All resources - result
Quick search All resources
Summary
| Resource Type | Hit Count |
|---|---|
| Gene Mutants | 2hits |
| Culture Condition | 3hits |
| ASKA Clone(-) | 1hits |
| ASKA Clone(+) | 1hits |
| Gateway Entry Clone library | 1hits |
| Mobile Plasmid Clone | 1hits |
| Cosmid Collection | 0hits |
| pLC Plasmid Collection | 0hits |
| Keio Collection | 1hits |
| Large-scale chromosomal deletion mutant (Tokyo Metropolitan University Group) | 17hits |
| NIG Wide Deletion Strain Collection (NEDO project) | 0hits |
| Transposon insertion disruptant | 0hits |
| Transposon insertion disruptant (cis partial doublet strain) | 2hits |
| Phage | 0hits |
| Cloning Vector Collection | 0hits |
| Cloning Vector CollectionHost Cell | 0hits |
| Antibody | 0hits |
Gene Mutants - List
Search Condition : (Keyword = recB b2820 ECK2816 ior JW2788 rorA)
2hits
First Previous 1-2 Next Last AllCulture Condition - List
Search Condition : (Keyword = recB b2820 ECK2816 ior JW2788 rorA)
3hits
First Previous 1-3 Next Last AllASKA Clone(-) - List
Search Condition : (Keyword = recB b2820 ECK2816 ior JW2788 rorA)
1hits
First Previous 1-1 Next Last All|
Resource No (JW ID)
|
Gene Name
|
Primer Sequence for N terminal | Primer Sequence for C terminal | Comment | Request |
|---|---|---|---|---|---|
| JW2788-AM | recB | GCCAGTGATGTCGCCGAGACACT | CCgGCCTCCTCCAGGGTCATACC | Clone OK |
ASKA Clone(+) - List
Search Condition : (Keyword = recB b2820 ECK2816 ior JW2788 rorA)
1hits
First Previous 1-1 Next Last All|
Resource No (JW ID)
|
Gene Name
|
Primer Sequence for N terminal | Primer Sequence for C terminal | Comment | Request |
|---|---|---|---|---|---|
| JW2788-AP | recB | GCCAGTGATGTCGCCGAGACACT | CCgGCCTCCTCCAGGGTCATACC | Clone OK |
Gateway Entry Clone library - List
Search Condition : (Keyword = recB b2820 ECK2816 ior JW2788 rorA)
1hits
First Previous 1-1 Next Last All|
Resource No (JW ID)
|
Gene Name
|
Clone verification class | Cloning Method | Request |
|---|---|---|---|---|
| JW2788-GE | recB | C | ASKA to pDONR/zeo |
Mobile Plasmid Collection - List
Search Condition : (Keyword = recB b2820 ECK2816 ior JW2788 rorA)
1hits
First Previous 1-1 Next Last All| Accession No | ORF No.(Japan) | ORF No.(USA) | Gene Name | Length | Source | Plasmid | Request |
|---|---|---|---|---|---|---|---|
| 2707 | 460#1 | b2820 | recB | 3543 | pNTR-SD |
Keio Collection - List
Search Condition : (Keyword = recB b2820 ECK2816 ior JW2788 rorA)
1hits
First Previous 1-1 Next Last All|
Resource No (JW ID)
|
Gene Name
|
Comment |
Cell Shape |
Cell Shape Image | Request |
|---|---|---|---|---|---|
| JW2788-KC | recB | ready to distribute | Long and Short |
![]() |
Large-scale chromosomal deletion mutant (Tokyo Metropolitan University Group) - List
Search Condition : (Keyword = recB b2820 ECK2816 ior JW2788 rorA)
17hits
First Previous 1-10 11-17 Next Last All| ME NO |
Deletion
|
Strain | System | plasmid(C-D) | Vector | Chromosomal Markers | Parent Recipient | Request |
|---|---|---|---|---|---|---|---|---|
| ME5076 | 1655 rsh | Δ(recB ptr recC recD)::Plac-(bet exo kan) rpsL hsdR::bla | MG1655 rpsL hsdR::bla | |||||
| ME5077 | LD-1 (crs) | Δ(recB ptr recC recD)::Plac-(bet exo kan) rpsL hsdR::bla Δ(yjgR-yjjA)::CRS | 1655 rsh | |||||
| ME5078 | LD-2-1 (crs) | Δ(recB ptr recC recD)::Plac-(bet exo kan) rpsL hsdR::bla Δ(rhsB-yiaE)::CRS | 1655 rsh | |||||
| ME5080 | LD-2-2 (crs) | Δ(recB ptr recC recD)::Plac-(bet exo kan) rpsL hsdR::bla Δ(yiaH-yibI)::CRS | 1655 rsh | |||||
| ME5082 | LD-4 (crs) | Δ(recB ptr recC recD)::Plac-(bet exo kan) rpsL hsdR::bla Δ(yjcD-cadC)::CRS | 1655 rsh | |||||
| ME5084 | LD-5 (crs) | Δ(recB ptr recC recD)::Plac-(bet exo kan) rpsL hsdR::bla Δ(yqjL-b3122)::CRS | 1655 rsh | |||||
| ME5087 | LD-13 (crs) | Δ(recB ptr recC recD)::Plac-(bet exo kan) rpsL hsdR::bla Δ(yfaE-b2275)::CRS | 1655 rsh | |||||
| ME5088 | LD-13 (po) | Δ(recB ptr recC recD)::Plac-(bet exo kan) rpsL hsdR::bla Δ(yfaE-b2275) | 1655 rsh | |||||
| ME5090 | LD-14 (crs) | Δ(recB ptr recC recD)::Plac-(bet exo kan) rpsL hsdR::bla Δ(yejO-alkB)::CRS | 1655 rsh | |||||
| ME5093 | LD-16-1-2 (crs) | Δ(recB ptr recC recD)::Plac-(bet exo kan) rpsL hsdR::bla Δ(yeeE-mrp)::CRS | 1655 rsh |





