Search All resources - result
Quick search All resources
Summary
| Resource Type | Hit Count |
|---|---|
| Gene Mutants | 2hits |
| Culture Condition | 0hits |
| ASKA Clone(-) | 1hits |
| ASKA Clone(+) | 1hits |
| Gateway Entry Clone library | 1hits |
| Mobile Plasmid Clone | 1hits |
| Cosmid Collection | 0hits |
| pLC Plasmid Collection | 1hits |
| Keio Collection | 1hits |
| Large-scale chromosomal deletion mutant (Tokyo Metropolitan University Group) | 1hits |
| NIG Wide Deletion Strain Collection (NEDO project) | 0hits |
| Transposon insertion disruptant | 0hits |
| Transposon insertion disruptant (cis partial doublet strain) | 0hits |
| Phage | 0hits |
| Cloning Vector Collection | 0hits |
| Cloning Vector CollectionHost Cell | 0hits |
| Antibody | 0hits |
Gene Mutants - List
Search Condition : (Keyword = rbfA b3167 ECK3156 f133 JW3136 sdr-43 yhbB)
2hits
First Previous 1-2 Next Last All| ME No. | Strain Name | Sex | Genotype | Other Remarks | Gene Mutants Detail Info | Request |
|---|---|---|---|---|---|---|
| ME9118 | AQ527 | F- |
metE9 |
Possible Ls (Srm) strain: sensitive for rich media. Kogoma and Meyenburg., 1983, EMBO J., 2, 463-468. Ogawa et al., 1984, Proc. Natl. Acad. Sci. USA., 81, 1040-1044.
Further information: Kogoma T., 1997, Micrbiol. Mol. Biol. Rev., 61, 212-238. Kowalczykowski et al., 1994, Microbiol. Rev., 58, 401-465. |
||
| ME8475 | BW6164,CGSC6759 | Hfr |
thr-43::Tn1 |
|
ASKA Clone(-) - List
Search Condition : (Keyword = rbfA b3167 ECK3156 f133 JW3136 sdr-43 yhbB)
1hits
First Previous 1-1 Next Last All
Resource No (JW ID)
 |
Gene Name
|
Primer Sequence for N terminal | Primer Sequence for C terminal | Comment | Request |
|---|---|---|---|---|---|
| JW3136-AM | rbfA | GCCGCGAAAGAATTTGGTCGCCC | CCGTCCTCCTTGCTGTCGTCCGG | Clone OK |
ASKA Clone(+) - List
Search Condition : (Keyword = rbfA b3167 ECK3156 f133 JW3136 sdr-43 yhbB)
1hits
First Previous 1-1 Next Last All|
Resource No (JW ID)
|
Gene Name
|
Primer Sequence for N terminal | Primer Sequence for C terminal | Comment | Request |
|---|---|---|---|---|---|
| JW3136-AP | rbfA | GCCGCGAAAGAATTTGGTCGCCC | CCGTCCTCCTTGCTGTCGTCCGG | Clone OK |
Gateway Entry Clone library - List
Search Condition : (Keyword = rbfA b3167 ECK3156 f133 JW3136 sdr-43 yhbB)
1hits
First Previous 1-1 Next Last All|
Resource No (JW ID)
|
Gene Name
|
Clone verification class | Cloning Method | Request |
|---|---|---|---|---|
| JW3136-GE | rbfA | A | ASKA to pDONR/zeo |
Mobile Plasmid Collection - List
Search Condition : (Keyword = rbfA b3167 ECK3156 f133 JW3136 sdr-43 yhbB)
1hits
First Previous 1-1 Next Last All| Accession No | ORF No.(Japan) | ORF No.(USA) | Gene Name | Length | Source | Plasmid | Request |
|---|---|---|---|---|---|---|---|
| 3038 | 519#5 | b3167 | rbfA | 402 | pNTR-SD |
pLC Plasmid - List
Search Condition : (Keyword = rbfA b3167 ECK3156 f133 JW3136 sdr-43 yhbB)
1hits
First Previous 1-1 Next Last All| pLC Plasmid | Map Position(min)a | Kohara clones by hybridizedb and genesc | Request | |
|---|---|---|---|---|
| 41-7 | 41-7 | 55 | 5E10(430), 6F10(431), 8E12(432) | |
| * | flaN, flaBCOE, flaARQP(43 min) |
Keio Collection - List
Search Condition : (Keyword = rbfA b3167 ECK3156 f133 JW3136 sdr-43 yhbB)
1hits
First Previous 1-1 Next Last All|
Resource No (JW ID)
|
Gene Name
|
Comment |
Cell Shape |
Cell Shape Image | Request |
|---|---|---|---|---|---|
| JW3136-KC | rbfA | ready to distribute | Normal |
 |
Large-scale chromosomal deletion mutant (Tokyo Metropolitan University Group) - List
Search Condition : (Keyword = rbfA b3167 ECK3156 f133 JW3136 sdr-43 yhbB)
1hits
First Previous 1-1 Next Last All
