Search All resources - result
Quick search All resources
Summary
| Resource Type | Hit Count |
|---|---|
| Gene Mutants | 0hits |
| Culture Condition | 0hits |
| ASKA Clone(-) | 0hits |
| ASKA Clone(+) | 1hits |
| Gateway Entry Clone library | 0hits |
| Mobile Plasmid Clone | 1hits |
| Cosmid Collection | 0hits |
| pLC Plasmid Collection | 0hits |
| Keio Collection | 1hits |
| Large-scale chromosomal deletion mutant (Tokyo Metropolitan University Group) | 0hits |
| NIG Wide Deletion Strain Collection (NEDO project) | 0hits |
| Transposon insertion disruptant | 2hits |
| Transposon insertion disruptant (cis partial doublet strain) | 0hits |
| Phage | 0hits |
| Cloning Vector Collection | 0hits |
| Cloning Vector CollectionHost Cell | 0hits |
| Antibody | 0hits |
ASKA Clone(+) - List
Search Condition : (Keyword = nadR)
1hits
First Previous 1-1 Next Last All|
Resource No (JW ID)
|
Gene Name
|
Primer Sequence for N terminal | Primer Sequence for C terminal | Comment | Request |
|---|---|---|---|---|---|
| JW5800-AP | nadR | GCCTCGTCATTTGATTACCTGAA | CCTCTCTGCTCCCCCATCATCTC | "No-GFP-minus, this clone is mixture of wild and pointmutant, reclone planned" |
Mobile Plasmid Collection - List
Search Condition : (Keyword = nadR)
1hits
First Previous 1-1 Next Last All| Accession No | ORF No.(Japan) | ORF No.(USA) | Gene Name | Length | Source | Plasmid | Request |
|---|---|---|---|---|---|---|---|
| 4207 | 675#4 | b4390 | nadR | 1254 | pNT3 |
Keio Collection - List
Search Condition : (Keyword = nadR)
1hits
First Previous 1-1 Next Last All|
Resource No (JW ID)
|
Gene Name
|
Comment |
Cell Shape |
Cell Shape Image | Request |
|---|---|---|---|---|---|
| JW5800-KC | nadR | ready to distribute | Short |
![]() |





