Search All resources - result
Quick search All resources
Summary
| Resource Type | Hit Count |
|---|---|
| Gene Mutants | 8hits |
| Culture Condition | 1hits |
| ASKA Clone(-) | 1hits |
| ASKA Clone(+) | 1hits |
| Gateway Entry Clone library | 1hits |
| Mobile Plasmid Clone | 1hits |
| Cosmid Collection | 0hits |
| pLC Plasmid Collection | 1hits |
| Keio Collection | 0hits |
| Large-scale chromosomal deletion mutant (Tokyo Metropolitan University Group) | 0hits |
| NIG Wide Deletion Strain Collection (NEDO project) | 0hits |
| Transposon insertion disruptant | 0hits |
| Transposon insertion disruptant (cis partial doublet strain) | 2hits |
| Phage | 0hits |
| Cloning Vector Collection | 0hits |
| Cloning Vector CollectionHost Cell | 0hits |
| Antibody | 0hits |
Gene Mutants - List
Search Condition : (Keyword = murF b0086 ECK0087 JW0084 mra)
8hits
First Previous 1-8 Next Last All| ME No. | Strain Name | Sex | Genotype | Other Remarks | Gene Mutants Detail Info | Request |
|---|---|---|---|---|---|---|
| JE6607 | MURF 4206 | F- |
murF DE(pr |
|
||
| JE6611 | MRA 2201 | F- |
murC DE(pr |
|
||
| JE6613 | MRA 6401 | F- |
ddl DE(pr |
|
||
| JE6616 | MRA 7201 | F- |
mraST772 DE(pr |
|
||
| JE6624 | MURF 4221 | F- |
murF DE(pr |
|
||
| JE6612 | ST640 | F- | thr leu thi trp his thy mra lac gal xyl mtl ara str azi |
salt repairable? (incomplete septation)
|
||
| JE6610 | ST222 | F- | thr leu thi trp his thy murC lac gal xyl mtl ara strA azi |
salt repairable?
|
||
| JE6606 | PC1242=TKL-46 | F- | thr leu thi pyrF codA thyA argG ilvA his murF lacY xyl tonA tsx phx supE ths dra sus uvrB vtr |
salt repairable
|
Culture Condition - List
Search Condition : (Keyword = murF b0086 ECK0087 JW0084 mra)
1hits
First Previous 1-1 Next Last All| Gene Symbol | Mnemonic | Synonyms |
|---|---|---|
| murF | murein | mra |
ASKA Clone(-) - List
Search Condition : (Keyword = murF b0086 ECK0087 JW0084 mra)
1hits
First Previous 1-1 Next Last All
Resource No (JW ID)
 |
Gene Name
|
Primer Sequence for N terminal | Primer Sequence for C terminal | Comment | Request |
|---|---|---|---|---|---|
| JW0084-AM | murF | GCCATTAGCGTAACCCTTAGCCA | CCACATGTCCCATTCTCCTGTAA | Clone OK |
ASKA Clone(+) - List
Search Condition : (Keyword = murF b0086 ECK0087 JW0084 mra)
1hits
First Previous 1-1 Next Last All|
Resource No (JW ID)
|
Gene Name
|
Primer Sequence for N terminal | Primer Sequence for C terminal | Comment | Request |
|---|---|---|---|---|---|
| JW0084-AP | murF | GCCATTAGCGTAACCCTTAGCCA | CCACATGTCCCATTCTCCTGTAA | Clone OK |
Gateway Entry Clone library - List
Search Condition : (Keyword = murF b0086 ECK0087 JW0084 mra)
1hits
First Previous 1-1 Next Last All|
Resource No (JW ID)
|
Gene Name
|
Clone verification class | Cloning Method | Request |
|---|---|---|---|---|
| JW0084-GE | murF | A | ASKA to pDONR/zeo |
Mobile Plasmid Collection - List
Search Condition : (Keyword = murF b0086 ECK0087 JW0084 mra)
1hits
First Previous 1-1 Next Last All| Accession No | ORF No.(Japan) | ORF No.(USA) | Gene Name | Length | Source | Plasmid | Request |
|---|---|---|---|---|---|---|---|
| 77 | 110#4 | b0086 | murF | 1359 | pNTR-SD |
pLC Plasmid - List
Search Condition : (Keyword = murF b0086 ECK0087 JW0084 mra)
1hits
First Previous 1-1 Next Last All| pLC Plasmid | Map Position(min)a | Kohara clones by hybridizedb and genesc | Request | |
|---|---|---|---|---|
| 26-6 | 26-6 | 2 | 6C1(109), 6F3(110), 15B8(111) | |
| * | leuA, ilvIH, mafB, serR, arl, polB, mraAB, pbpB, murE, murF(2 min) |
