Search All resources - result
Quick search All resources
Summary
| Resource Type | Hit Count |
|---|---|
| Gene Mutants | 22hits |
| Culture Condition | 1hits |
| ASKA Clone(-) | 1hits |
| ASKA Clone(+) | 1hits |
| Gateway Entry Clone library | 1hits |
| Mobile Plasmid Clone | 1hits |
| Cosmid Collection | 0hits |
| pLC Plasmid Collection | 2hits |
| Keio Collection | 1hits |
| Large-scale chromosomal deletion mutant (Tokyo Metropolitan University Group) | 0hits |
| NIG Wide Deletion Strain Collection (NEDO project) | 0hits |
| Transposon insertion disruptant | 2hits |
| Transposon insertion disruptant (cis partial doublet strain) | 0hits |
| Phage | 0hits |
| Cloning Vector Collection | 0hits |
| Cloning Vector CollectionHost Cell | 0hits |
| Antibody | 0hits |
Gene Mutants - List
Search Condition : (Keyword = metC b3008 ECK3000 JW2975)
22hits
First Previous 1-10 11-20 21-22 Next Last All| ME No. | Strain Name | Sex | Genotype | Other Remarks | Gene Mutants Detail Info | Request |
|---|---|---|---|---|---|---|
| ME8462 | JB42 | Hfr |
malTC-1 lamB1 |
|
||
| ME8463 | Pop1153 | Hfr |
his malE2 |
|
||
| ME8465 | JB100 | Hfr |
malTC-1 ompR::Tn1 |
|
||
| ME8466 | JB105 | Hfr |
malTC-1 ompR: |
|
||
| ME8486 | BW2000 | Hfr |
his mgl:: |
|
||
| ME8692 | PSM3 | F- | glnP glnPo metC thi |
|
||
| JE5528 | G6 Lpm#7 | Hfr | lpm trp malB |
|
||
| JE5818 | D1 | Hfr | ftsD thr thi trp argH malA mtl xyl mel str his |
|
||
| JE7616 | 6111male | Hfr | asnA asnB thi? str |
|
||
| JE5596 | G6 | Hfr | malB his |
|
Culture Condition - List
Search Condition : (Keyword = metC b3008 ECK3000 JW2975)
1hits
First Previous 1-1 Next Last All| Gene Symbol | Mnemonic | Synonyms |
|---|---|---|
| metC | methionine |
ASKA Clone(-) - List
Search Condition : (Keyword = metC b3008 ECK3000 JW2975)
1hits
First Previous 1-1 Next Last All
Resource No (JW ID)
 |
Gene Name
|
Primer Sequence for N terminal | Primer Sequence for C terminal | Comment | Request |
|---|---|---|---|---|---|
| JW2975-AM | metC | GCCGCGGACAAAAAGCTTGATAC | CCTACAATTCGCGCAAAACCGGC | Clone OK |
ASKA Clone(+) - List
Search Condition : (Keyword = metC b3008 ECK3000 JW2975)
1hits
First Previous 1-1 Next Last All|
Resource No (JW ID)
|
Gene Name
|
Primer Sequence for N terminal | Primer Sequence for C terminal | Comment | Request |
|---|---|---|---|---|---|
| JW2975-AP | metC | GCCGCGGACAAAAAGCTTGATAC | CCTACAATTCGCGCAAAACCGGC | Clone OK |
Gateway Entry Clone library - List
Search Condition : (Keyword = metC b3008 ECK3000 JW2975)
1hits
First Previous 1-1 Next Last All|
Resource No (JW ID)
|
Gene Name
|
Clone verification class | Cloning Method | Request |
|---|---|---|---|---|
| JW2975-GE | metC | A | ASKA to pDONR/zeo |
Mobile Plasmid Collection - List
Search Condition : (Keyword = metC b3008 ECK3000 JW2975)
1hits
First Previous 1-1 Next Last All| Accession No | ORF No.(Japan) | ORF No.(USA) | Gene Name | Length | Source | Plasmid | Request |
|---|---|---|---|---|---|---|---|
| 2886 | 505#5 | b3008 | metC | 1188 | pNTR-SD |
pLC Plasmid - List
Search Condition : (Keyword = metC b3008 ECK3000 JW2975)
2hits
First Previous 1-2 Next Last All| pLC Plasmid | Map Position(min)a | Kohara clones by hybridizedb and genesc | Request | |
|---|---|---|---|---|
| 4-14 | 4-14 | * | pbp(2 min) | |
| * | metC(65 min) | |||
| 65 | 5C10(504), 6H4(505), 17B2(506) | |||
| 37-24 | 37-24 | 36 | 6A5(314), 9A1(315), 20B5(316) | |
| 49 | 4B4(379), 5H12(380) | |||
| * | metC(65 min) |
Keio Collection - List
Search Condition : (Keyword = metC b3008 ECK3000 JW2975)
1hits
First Previous 1-1 Next Last All|
Resource No (JW ID)
|
Gene Name
|
Comment |
Cell Shape |
Cell Shape Image | Request |
|---|---|---|---|---|---|
| JW2975-KC | metC | ready to distribute | Normal |
 |
