This page requires JavaScript to function properly. Please enable JavaScript in your browser to view this page.

Search All resources - result

Quick search All resources

Keyword

Summary

Resource Type	Hit Count
Gene Mutants	891hits
Culture Condition	2hits
ASKA Clone(-)	1hits
ASKA Clone(+)	1hits
Gateway Entry Clone library	1hits
Mobile Plasmid Clone	74hits
Cosmid Collection	0hits
pLC Plasmid Collection	3hits
Keio Collection	1hits
Large-scale chromosomal deletion mutant (Tokyo Metropolitan University Group)	124hits
NIG Wide Deletion Strain Collection (NEDO project)	0hits
Transposon insertion disruptant	2hits
Transposon insertion disruptant (cis partial doublet strain)	0hits
Phage	0hits
Cloning Vector Collection	6hits
Cloning Vector CollectionHost Cell	1hits
Antibody	0hits

Gene Mutants - List

Search Condition : (Keyword = metB b3939 ECK3931 JW3910 met-1 o386)

891hits First Previous 1-10 11-20 21-30 31-40 41-50 51-60 Next Last All

ME No.	Strain Name	Sex	Genotype	Other Remarks	PubMed ID[RRC reference]
JE6814	Met-1	F^-	tonA ara thi ilvA mtl xyl malA str his gal tsx lac
JE6810	Met-3	F^-	tonA ara thi argH ilvA mtl xyl malA str his gal tsx lac
JE5753	JE5752M⁺1	Hfr	ponB353 leuA tonA proA DE(lac) malA tsx
ME9227	AQ2547	F^-	trpA9605 his-29 thyA deoB (or deoC) pro metB ilv dnaA5		9079893 [RRC:30144]
JE5657	1a^tsmD4	F^-	ponA1104 dacA1191 dacB12 tsx? DE(lac72?) proA? metD1 metB str	L-Met 100_micro_g/ml supplemented
ME8475	BW6164,CGSC6759	Hfr	thr-43::Tn10 supE42 (lambda)^- malB28(lambda)^R Sfa-4
ME6221	HfrP₄X Ilv TL Met Str	Hfr	ilv thr leu met str
JE5664	maleB	Hfr	dacA1191 his
JE5720	64-42	F^-	dacB64 ts64 thr leu thi argH trp lac str
JE5744	JE5733/1b⁺3.LA.3	F⁺	ponA^ts1104 rodAsp6 dacB12 leuA(thr thi) str dap lys sup-126? trp Eam?	Supplement 50_micro_g/ml DAP

891hits First Previous 1-10 11-20 21-30 31-40 41-50 51-60 Next Last All

Culture Condition - List

Search Condition : (Keyword = metB b3939 ECK3931 JW3910 met-1 o386)

2hits First Previous 1-2 Next Last All

Gene Symbol	Mnemonic	Synonyms	Gene Product
metB	methionine	met₁ met-1	cystathionine gamma-synthase
sucB	succinate	lys met	dihydrolipoamide succinyltransferase, component of alpha-ketoglutarate deHase

2hits First Previous 1-2 Next Last All

ASKA Clone(-) - List

Search Condition : (Keyword = metB b3939 ECK3931 JW3910 met-1 o386)

1hits First Previous 1-1 Next Last All

Resource No (JW ID)	Gene Name	Primer Sequence for N terminal	Primer Sequence for C terminal	Comment	PubMed ID[RRC reference]	Request
JW3910-AM	metB	GCCACGCGTAAACAGGCCACCAT	CCgCCCTTGTTTGCAGCCCGGAA	Clone OK

1hits First Previous 1-1 Next Last All

ASKA Clone(+) - List

Search Condition : (Keyword = metB b3939 ECK3931 JW3910 met-1 o386)

1hits First Previous 1-1 Next Last All

Resource No (JW ID)	Gene Name	Primer Sequence for N terminal	Primer Sequence for C terminal	Comment	PubMed ID[RRC reference]	Request
JW3910-AP	metB	GCCACGCGTAAACAGGCCACCAT	CCgCCCTTGTTTGCAGCCCGGAA	Clone OK

1hits First Previous 1-1 Next Last All

Gateway Entry Clone library - List

Search Condition : (Keyword = metB b3939 ECK3931 JW3910 met-1 o386)

1hits First Previous 1-1 Next Last All

Resource No (JW ID)	Gene Name	Clone verification class	Cloning Method	PubMed ID[RRC reference]	Request
JW3910-GE	metB	C	ASKA to pDONR/zeo

1hits First Previous 1-1 Next Last All

Mobile Plasmid Collection - List

Search Condition : (Keyword = metB b3939 ECK3931 JW3910 met-1 o386)

74hits First Previous 1-10 11-20 21-30 31-40 41-50 51-60 Next Last All

Accession No	ORF No.(Japan)	ORF No.(USA)	Gene Name	Length	Source	Plasmid
3224	538#13	b3939	metB	1161		pNTR-SD
1283	(261#1.1)		261#1.1	126		pNTR-SD
1418	(277#1.1)		277#1.1	171		pNTR-SD
2548	443#1.1	b2649	443#1.1	792		pNTR-SD
3207	537#1.1		537#1.1	549		pNTR-SD
3544	577#1.1		577#1.1	213		pNT3
381	(146#1)		146#1	-1		pNTR-SD
472	156#1	b0502	156#1	372	USA	pNT3
974	229#1	b1017	229#1	732		pNTR-SD
1117	242#1	b1163	242#1	1212		pNTR-SD

74hits First Previous 1-10 11-20 21-30 31-40 41-50 51-60 Next Last All

pLC Plasmid - List

Search Condition : (Keyword = metB b3939 ECK3931 JW3910 met-1 o386)

3hits First Previous 1-3 Next Last All

pLC Plasmid	Map Position(min)^a	Kohara clones by hybridized^b and genes^c	PubMed ID[RRC reference]
3-13	3-13	*	lsp(1 min)
3-13	35	12E2(308), 7B6(309), 6F6(310)
4-46	4-46	*	folA(1 min)
4-46	1	2F7(104), 4A3(105), 8D2(106)
14-37	14-37	*	trkC, folA, ksgA, pdxA(1 min)
14-37	1	2F7(104), 4A3(105), 8D2(106)

3hits First Previous 1-3 Next Last All

Keio Collection - List

Search Condition : (Keyword = metB b3939 ECK3931 JW3910 met-1 o386)

1hits First Previous 1-1 Next Last All

Resource No (JW ID)	Gene Name	Comment	Cell Shape	Cell Shape Image	PubMed ID[RRC reference]	Request
JW3910-KC	metB	ready to distribute	Normal

1hits First Previous 1-1 Next Last All

Large-scale chromosomal deletion mutant (Tokyo Metropolitan University Group) - List

Search Condition : (Keyword = metB b3939 ECK3931 JW3910 met-1 o386)

124hits First Previous 1-10 11-20 21-30 31-40 41-50 51-60 Next Last All

ME NO	Deletion	Strain	System	Chromosomal Markers	Parent Recipient
ME5096	LD-16-2 (crs)			rpsL Δ(molR_1-yeiB)	1655 rpsL
ME5097	LD-16-2 (po)			rpsL Δ(molR_1-yeiB)	1655 rpsL
ME5095	LD-16-1-2 (po)&16-2 (po)			rpsL Δ(molR_1-yeiB, yeeE-mrp)	1655 rpsL
ME4570	OCL01-1	MG1655 red D(OCL1-1):Cm No.1	red(SD8)
ME4589	OCL12-1	MG1655 rpsL polA12 D(OCL12-1-1):Km	664
ME4597	OCL18-1	MG1655 red D(OCL18-1):Cm No.1	red(SD7)
ME4605	OCL22-1	MG1655 red D(OCL22-1):Cm No.1	red(SD7)
ME4622	OCL26-1	MG1655 red D(OCL26-1):Cm No.1	red(SD7)
ME4626	OCL27-1	MG1655 red D(OCL27-1):Cm No.1	red(SD6)
ME4666	OCL39-1	MG1655 red D(OCL39-1):Cm No.1	red(SD6)

124hits First Previous 1-10 11-20 21-30 31-40 41-50 51-60 Next Last All

Transposon insertion disruptant - List

Search Condition : (Keyword = metB b3939 ECK3931 JW3910 met-1 o386)

2hits First Previous 1-2 Next Last All

Strain No	Insertion site (inserted after)	MG1655 Gene name	PubMed ID[RRC reference]	Request
JD24866	4126757	metB
JD24867	4127547	metB

2hits First Previous 1-2 Next Last All

Cloning Vector Collection - List

Search Condition : (Keyword = metB b3939 ECK3931 JW3910 met-1 o386)

6hits First Previous 1-6 Next Last All

Name	Replicon	Size	Purpose	Selectable Markers	PubMed ID[RRC reference]	Map	Sequence
pGFIB-1	pMB1/f1	3.877	Expression	amp		pGFIB-1 Map.png	pGFIB-1_assembly.fasta
pSSVI216-1	p15A	3.68	General	kan		pSSVI216-1_hybrid Map.png	pSSVI216-1_hybrid.fasta
pTSV-1	pMB1	10.336	Translational signal	tet		pTSV-1 Map.png	pTSV-1.fasta
pLUXascGp	sc101	9.699	promoter assay	kan	33654727 [RRC:74727]
pLUXddlAp	sc101	9.874	promoter assay	kan	33654727 [RRC:74727]
pLUXgadCp	sc101	9.874	promoter assay	kan	33654727 [RRC:74727]

6hits First Previous 1-6 Next Last All

Cloning Vector CollectionHost Cell -List

Search Condition : (Keyword = metB b3939 ECK3931 JW3910 met-1 o386)

1hits First Previous 1-1 Next Last All

CV No.	Name	Genotype	Gene Mutants Detail Info	PubMed ID[RRC reference]	Request
CV-77	Y1088	e14-, (McrA-), del(lac)U169, supE, supF, hsdR, metB, trpR,tonA21, proC::Tn5, (pMC9(Amp-r, Tet-r))	Reference Genome: MG1655 (Accession No. NC_000913)

1hits First Previous 1-1 Next Last All

Shopping Cart

Error

Search All resources - result

Quick search All resources

Summary

Gene Mutants - List

Culture Condition - List

ASKA Clone(-) - List

ASKA Clone(+) - List

Gateway Entry Clone library - List

Mobile Plasmid Collection - List

pLC Plasmid - List

Keio Collection - List

Large-scale chromosomal deletion mutant (Tokyo Metropolitan University Group) - List

Transposon insertion disruptant - List

Cloning Vector Collection - List

Cloning Vector CollectionHost Cell -List