Search All resources - result
Quick search All resources
Summary
| Resource Type | Hit Count |
|---|---|
| Gene Mutants | 49hits |
| Culture Condition | 1hits |
| ASKA Clone(-) | 1hits |
| ASKA Clone(+) | 1hits |
| Gateway Entry Clone library | 1hits |
| Mobile Plasmid Clone | 1hits |
| Cosmid Collection | 0hits |
| pLC Plasmid Collection | 1hits |
| Keio Collection | 1hits |
| Large-scale chromosomal deletion mutant (Tokyo Metropolitan University Group) | 0hits |
| NIG Wide Deletion Strain Collection (NEDO project) | 0hits |
| Transposon insertion disruptant | 0hits |
| Transposon insertion disruptant (cis partial doublet strain) | 2hits |
| Phage | 0hits |
| Cloning Vector Collection | 0hits |
| Cloning Vector CollectionHost Cell | 0hits |
| Antibody | 0hits |
Gene Mutants - List
Search Condition : (Keyword = lipA b0628 ECK0621 JW0623 lip)
49hits
First Previous 1-10 11-20 21-30 31-40 41-49 Next Last All| ME No. | Strain Name | Sex | Genotype | Other Remarks | Gene Mutants Detail Info | Request |
|---|---|---|---|---|---|---|
| JE7533 | EntA+lip-3 | F- |
lip-9 thi leu proC trpE supE4 |
|
||
| JE7404 | lip+AB#4 | F- |
thi-1 his-4 proA2 purB1 |
cf. PBP-5- isogenic = JE7401 & JE7402 penG MIC = 20_micro_g/ml, TR, PlS
|
||
| JE7405 | lip+AB#9 | F- |
thi-1 his-4 proA2 purB1 |
TR. PlS cf. PBP-5-isogenic = JE7401&JE7402
|
||
| JE7517 | Lip+leuS+1 | F- | thi his proA purB mtl xyl galK lacY str supE |
|
||
| JE7527 | Lip+ent+1 | F- | thi his proA purB mtl xyl galK lacY str supE |
|
||
| JE7529 | Lip+ent-7 | F- | entA thi his proA purB mtl xyl galK lacY str supE |
|
||
| JE7410 | JE7092 Lip+#3 | F- | dap lys argG xyl str |
P1S cf. dacA- isogenic = JE7411
|
||
| JE7411 | JE7092 lip+#47 | F- |
dacA1 |
PenGS, P1S cf. dacA+ isogenic = JE7410 Supplement 50_micro_g/ml DAP
|
||
| JE7418 | 7092 lip+#9 | F- | pfv dap lys argG xyl str |
Supplement 50_micro_g/ml DAP
|
||
| JE7518 | Lip+ LeuS- 2 | F- | leuS thi his proA purB mtl xyl galK lacY str supE |
|
Culture Condition - List
Search Condition : (Keyword = lipA b0628 ECK0621 JW0623 lip)
1hits
First Previous 1-1 Next Last All| Gene Symbol | Mnemonic | Synonyms |
|---|---|---|
| lipA | lipoate |
ASKA Clone(-) - List
Search Condition : (Keyword = lipA b0628 ECK0621 JW0623 lip)
1hits
First Previous 1-1 Next Last All
Resource No (JW ID)
 |
Gene Name
|
Primer Sequence for N terminal | Primer Sequence for C terminal | Comment | Request |
|---|---|---|---|---|---|
| JW0623-AM | lipA | GCCAGTAAACCCATTGTGATGGA | CCCTTAACTTCCATCCCTTTCGC | Clone OK |
ASKA Clone(+) - List
Search Condition : (Keyword = lipA b0628 ECK0621 JW0623 lip)
1hits
First Previous 1-1 Next Last All|
Resource No (JW ID)
|
Gene Name
|
Primer Sequence for N terminal | Primer Sequence for C terminal | Comment | Request |
|---|---|---|---|---|---|
| JW0623-AP | lipA | GCCAGTAAACCCATTGTGATGGA | CCCTTAACTTCCATCCCTTTCGC | Clone OK |
Gateway Entry Clone library - List
Search Condition : (Keyword = lipA b0628 ECK0621 JW0623 lip)
1hits
First Previous 1-1 Next Last All|
Resource No (JW ID)
|
Gene Name
|
Clone verification class | Cloning Method | Request |
|---|---|---|---|---|
| JW0623-GE | lipA | A | ASKA to pDONR/zeo |
Mobile Plasmid Collection - List
Search Condition : (Keyword = lipA b0628 ECK0621 JW0623 lip)
1hits
First Previous 1-1 Next Last All| Accession No | ORF No.(Japan) | ORF No.(USA) | Gene Name | Length | Source | Plasmid | Request |
|---|---|---|---|---|---|---|---|
| 597 | 168#13 | b0628 | lipA | 966 | pNTR-SD |
pLC Plasmid - List
Search Condition : (Keyword = lipA b0628 ECK0621 JW0623 lip)
1hits
First Previous 1-1 Next Last All| pLC Plasmid | Map Position(min)a | Kohara clones by hybridizedb and genesc | Request | |
|---|---|---|---|---|
| 15-5 | 15-5 | 15 | 4A5(166), 3G5(167), 1G6(168) | |
| * | lip, dacA, envT, rodA, pbpA, leuS(15 min) |
Keio Collection - List
Search Condition : (Keyword = lipA b0628 ECK0621 JW0623 lip)
1hits
First Previous 1-1 Next Last All|
Resource No (JW ID)
|
Gene Name
|
Comment |
Cell Shape |
Cell Shape Image | Request |
|---|---|---|---|---|---|
| JW0623-KC | lipA | ready to distribute | Normal |
 |
