Search All resources - result
Quick search All resources
Summary
| Resource Type | Hit Count |
|---|---|
| Gene Mutants | 7hits |
| Culture Condition | 0hits |
| ASKA Clone(-) | 1hits |
| ASKA Clone(+) | 1hits |
| Gateway Entry Clone library | 1hits |
| Mobile Plasmid Clone | 1hits |
| Cosmid Collection | 0hits |
| pLC Plasmid Collection | 0hits |
| Keio Collection | 0hits |
| Large-scale chromosomal deletion mutant (Tokyo Metropolitan University Group) | 0hits |
| NIG Wide Deletion Strain Collection (NEDO project) | 0hits |
| Transposon insertion disruptant | 0hits |
| Transposon insertion disruptant (cis partial doublet strain) | 3hits |
| Phage | 0hits |
| Cloning Vector Collection | 0hits |
| Cloning Vector CollectionHost Cell | 0hits |
| Antibody | 0hits |
Gene Mutants - List
Search Condition : (Keyword = hemG b3850 ECK3842 JW3827 o181 yihB)
7hits
First Previous 1-7 Next Last All| ME No. | Strain Name | Sex | Genotype | Other Remarks | Gene Mutants Detail Info | Request |
|---|---|---|---|---|---|---|
| IH79 | W3110 hemG | F- | hemG |
|
 Reference Genome: MG1655 (Accession No. NC_000913) |
|
| IH86 | CR63 hemG | F+ | hemG supF λR |
|
Reference Genome: MG1655 (Accession No. NC_000913) |
|
| IH85 | BT3 hemG | F- | hemG metam3 lac1000 trpam strr bfeam tsxam su0 |
|
||
| IH87 | BT13 hemG | F- | hemG supD lac1000 trpam metam3 strr bfeam tsxam |
|
||
| IH76 | VSR800 | F+ |
hemG HfrC visA( |
The strain carrying a transducing phage of hemG+
|
Reference Genome: MG1655 (Accession No. NC_000913) |
|
| IH88 | LG285 | F- |
hemG supE4 |
|
Reference Genome: MG1655 (Accession No. NC_000913) |
|
| IH75 | VSR751 | F+ |
hemG HfrC visA( |
A point mutant of hemG
|
Reference Genome: MG1655 (Accession No. NC_000913) |
ASKA Clone(-) - List
Search Condition : (Keyword = hemG b3850 ECK3842 JW3827 o181 yihB)
1hits
First Previous 1-1 Next Last All
Resource No (JW ID)
 |
Gene Name
|
Primer Sequence for N terminal | Primer Sequence for C terminal | Comment | Request |
|---|---|---|---|---|---|
| JW3827-AM | hemG | GCCAAAACATTAATTCTTTTCTC | CCTTTCAGCGTCGGTTTGTCGGT | Clone OK |
ASKA Clone(+) - List
Search Condition : (Keyword = hemG b3850 ECK3842 JW3827 o181 yihB)
1hits
First Previous 1-1 Next Last All|
Resource No (JW ID)
|
Gene Name
|
Primer Sequence for N terminal | Primer Sequence for C terminal | Comment | Request |
|---|---|---|---|---|---|
| JW3827-AP | hemG | GCCAAAACATTAATTCTTTTCTC | CCTTTCAGCGTCGGTTTGTCGGT | Clone OK |
Gateway Entry Clone library - List
Search Condition : (Keyword = hemG b3850 ECK3842 JW3827 o181 yihB)
1hits
First Previous 1-1 Next Last All|
Resource No (JW ID)
|
Gene Name
|
Clone verification class | Cloning Method | Request |
|---|---|---|---|---|
| JW3827-GE | hemG | A | ASKA to pDONR/zeo |
Mobile Plasmid Collection - List
Search Condition : (Keyword = hemG b3850 ECK3842 JW3827 o181 yihB)
1hits
First Previous 1-1 Next Last All| Accession No | ORF No.(Japan) | ORF No.(USA) | Gene Name | Length | Source | Plasmid | Request |
|---|---|---|---|---|---|---|---|
| 3291 | 548#1 | b3850 | hemG | 546 | pNTR-SD |
Transposon insertion disruptant (cis partial doublet strain) - List
Search Condition : (Keyword = hemG b3850 ECK3842 JW3827 o181 yihB)
3hits
First Previous 1-3 Next Last All
