Search All resources - result
Quick search All resources
Summary
| Resource Type | Hit Count |
|---|---|
| Gene Mutants | 20hits |
| Culture Condition | 1hits |
| ASKA Clone(-) | 1hits |
| ASKA Clone(+) | 1hits |
| Gateway Entry Clone library | 1hits |
| Mobile Plasmid Clone | 2hits |
| Cosmid Collection | 0hits |
| pLC Plasmid Collection | 1hits |
| Keio Collection | 0hits |
| Large-scale chromosomal deletion mutant (Tokyo Metropolitan University Group) | 0hits |
| KHK Collection | 0hits |
| Transposon insertion disruptant | 0hits |
| Transposon insertion disruptant (cis partial doublet strain) | 2hits |
| Phage | 0hits |
| Cloning Vector Collection | 0hits |
| Cloning Vector CollectionHost Cell | 0hits | Antibody | 0hits |
Gene Mutants - List
Search Condition : (Keyword = ftsI b0084 ECK0085 JW0082 pbpB sep)
20hits
First Previous 1-10 11-20 Next Last All| ME No. | Strain Name | Sex | Genotype | Request |
|---|---|---|---|---|
| JE7603 | MI183eL+33#2 | F- | thi metE proC purE trp lys xyl lacZ str tonA tsx ftsI gal | |
| JE6647 | JE6268 rif nal ftsI | F- | purE trp lys proC thi lacZ xyl ara mtl mal (man) (gal) (mel) ftsI730 polA1 tonA tsx str rif nalA | |
| JE7602 | MI183eL+33#1 | F- | thi metE proC purE trp lys xyl lacZ str tonA tsx ftsI | |
| JE7584 | td2 | Hfr | thr thi leu ilvH nadC | |
| JE7582 | td1 | Hfr | thr thi leu ilvH | |
| JE6602 | HFI-4 | Hfr | ftsI thr leuA (thi) | |
| JE6603 | FI7301 | F- |
ftsI DE(pr |
|
| JE6622 | FI 3301 | F- |
ftsI33 DE(pr |
|
| JE7612 | 7602rec2 | F- | thi metE proC xyl lacZ str tonA tsx ftsI recA1 | |
| JE5754 | 1b-17 | F+ |
ponAts1104 ponB3 |
Culture Condition - List
Search Condition : (Keyword = ftsI b0084 ECK0085 JW0082 pbpB sep)
1hits
First Previous 1-1 Next Last All| Gene Symbol | Mnemonic | Synonyms |
|---|---|---|
| ftsI | filamentation, temperature sensitive | pbpB sep |
ASKA Clone(-) - List
Search Condition : (Keyword = ftsI b0084 ECK0085 JW0082 pbpB sep)
1hits
First Previous 1-1 Next Last All
Resource No (JW ID)
 |
Gene Name
|
Primer Sequence for N terminal | Primer Sequence for C terminal | Comment | Request |
|---|---|---|---|---|---|
| JW0082-AM | ftsI | GCCAAAGCAGCGGCGAAAACGCA | CCCGATCTGCCACCTGTCCCCTC | Clone OK |
ASKA Clone(+) - List
Search Condition : (Keyword = ftsI b0084 ECK0085 JW0082 pbpB sep)
1hits
First Previous 1-1 Next Last All|
Resource No (JW ID)
|
Gene Name
|
Primer Sequence for N terminal | Primer Sequence for C terminal | Comment | Request |
|---|---|---|---|---|---|
| JW0082-AP | ftsI | GCCAAAGCAGCGGCGAAAACGCA | CCCGATCTGCCACCTGTCCCCTC | Clone OK |
Gateway Entry Clone library - List
Search Condition : (Keyword = ftsI b0084 ECK0085 JW0082 pbpB sep)
1hits
First Previous 1-1 Next Last All|
Resource No (JW ID)
|
Gene Name
|
Clone verification class | Cloning Method | Request |
|---|---|---|---|---|
| JW0082-GE | ftsI | A | ASKA to pDONR/zeo |
Mobile Plasmid Collection - List
Search Condition : (Keyword = ftsI b0084 ECK0085 JW0082 pbpB sep)
2hits
First Previous 1-2 Next Last All| Accession No | ORF No.(Japan) | ORF No.(USA) | Gene Name | Length | Source | Plasmid | Request |
|---|---|---|---|---|---|---|---|
| 75 | 110#2 | b0084 | pbpB/ftsI | 1767 | pNTR-SD | ||
| 139 | 116#7 | b0149 | mrcB/pbpB | 2535 | pNTR-SD |
pLC Plasmid - List
Search Condition : (Keyword = ftsI b0084 ECK0085 JW0082 pbpB sep)
1hits
First Previous 1-1 Next Last All| pLC Plasmid | Map Position(min)a | Kohara clones by hybridizedb and genesc | Request | |
|---|---|---|---|---|
| 26-6 | 26-6 | 2 | 6C1(109), 6F3(110), 15B8(111) | |
| * | leuA, ilvIH, mafB, serR, arl, polB, mraAB, pbpB, murE, murF(2 min) |
