Search All resources - result
Quick search All resources
Summary
| Resource Type | Hit Count |
|---|---|
| Gene Mutants | 2hits |
| Culture Condition | 3hits |
| ASKA Clone(-) | 1hits |
| ASKA Clone(+) | 1hits |
| Gateway Entry Clone library | 1hits |
| Mobile Plasmid Clone | 1hits |
| Cosmid Collection | 0hits |
| pLC Plasmid Collection | 0hits |
| Keio Collection | 1hits |
| Large-scale chromosomal deletion mutant (Tokyo Metropolitan University Group) | 0hits |
| NIG Wide Deletion Strain Collection (NEDO project) | 0hits |
| Transposon insertion disruptant | 1hits |
| Transposon insertion disruptant (cis partial doublet strain) | 0hits |
| Phage | 0hits |
| Cloning Vector Collection | 0hits |
| Cloning Vector CollectionHost Cell | 0hits |
| Antibody | 0hits |
Gene Mutants - List
Search Condition : (Keyword = fabF b1095 ctr cvc ECK1081 fabJ JW1081 vtr)
2hits
First Previous 1-2 Next Last All| ME No. | Strain Name | Sex | Genotype | Other Remarks | Gene Mutants Detail Info | Request |
|---|---|---|---|---|---|---|
| JE6604 | PC-1237=TKL-11 | F- | thr leu thi pyrF codA thyA argG ilvA his murE lacY tonA tsx phx supE ths dra sus uvrB vtr |
no growth/LB+-NaCl at 41C
|
||
| JE6606 | PC1242=TKL-46 | F- | thr leu thi pyrF codA thyA argG ilvA his murF lacY xyl tonA tsx phx supE ths dra sus uvrB vtr |
salt repairable
|
Culture Condition - List
Search Condition : (Keyword = fabF b1095 ctr cvc ECK1081 fabJ JW1081 vtr)
3hits
First Previous 1-3 Next Last AllASKA Clone(-) - List
Search Condition : (Keyword = fabF b1095 ctr cvc ECK1081 fabJ JW1081 vtr)
1hits
First Previous 1-1 Next Last All
Resource No (JW ID)
 |
Gene Name
|
Primer Sequence for N terminal | Primer Sequence for C terminal | Comment | Request |
|---|---|---|---|---|---|
| JW1081-AM | fabF | GCCTCTAAGCGTCGTGTAGTTGT | CCGATCTTTTTAAAGATCAAAGA | Clone OK |
ASKA Clone(+) - List
Search Condition : (Keyword = fabF b1095 ctr cvc ECK1081 fabJ JW1081 vtr)
1hits
First Previous 1-1 Next Last All|
Resource No (JW ID)
|
Gene Name
|
Primer Sequence for N terminal | Primer Sequence for C terminal | Comment | Request |
|---|---|---|---|---|---|
| JW1081-AP | fabF | GCCTCTAAGCGTCGTGTAGTTGT | CCGATCTTTTTAAAGATCAAAGA | Clone OK |
Gateway Entry Clone library - List
Search Condition : (Keyword = fabF b1095 ctr cvc ECK1081 fabJ JW1081 vtr)
1hits
First Previous 1-1 Next Last All|
Resource No (JW ID)
|
Gene Name
|
Clone verification class | Cloning Method | Request |
|---|---|---|---|---|
| JW1081-GE | fabF | A | ASKA to pDONR/zeo |
Mobile Plasmid Collection - List
Search Condition : (Keyword = fabF b1095 ctr cvc ECK1081 fabJ JW1081 vtr)
1hits
First Previous 1-1 Next Last All| Accession No | ORF No.(Japan) | ORF No.(USA) | Gene Name | Length | Source | Plasmid | Request |
|---|---|---|---|---|---|---|---|
| 1048 | 236#4 | b1095 | fabF | 1242 | pNT3 |
Keio Collection - List
Search Condition : (Keyword = fabF b1095 ctr cvc ECK1081 fabJ JW1081 vtr)
1hits
First Previous 1-1 Next Last All|
Resource No (JW ID)
|
Gene Name
|
Comment |
Cell Shape |
Cell Shape Image | Request |
|---|---|---|---|---|---|
| JW1081-KC | fabF | ready to distribute | Normal |
 |
Transposon insertion disruptant - List
Search Condition : (Keyword = fabF b1095 ctr cvc ECK1081 fabJ JW1081 vtr)
1hits
First Previous 1-1 Next Last All| Strain No | Insertion site (inserted after) |
MG1655 Gene name |
Request |
|---|---|---|---|
| JD22140 | 1152213 | fabF |
