Search All resources - result
Quick search All resources
Summary
| Resource Type | Hit Count |
|---|---|
| Gene Mutants | 12hits |
| Culture Condition | 1hits |
| ASKA Clone(-) | 1hits |
| ASKA Clone(+) | 1hits |
| Gateway Entry Clone library | 1hits |
| Mobile Plasmid Clone | 1hits |
| Cosmid Collection | 0hits |
| pLC Plasmid Collection | 0hits |
| Keio Collection | 1hits |
| Large-scale chromosomal deletion mutant (Tokyo Metropolitan University Group) | 0hits |
| NIG Wide Deletion Strain Collection (NEDO project) | 0hits |
| Transposon insertion disruptant | 0hits |
| Transposon insertion disruptant (cis partial doublet strain) | 0hits |
| Phage | 0hits |
| Cloning Vector Collection | 0hits |
| Cloning Vector CollectionHost Cell | 0hits |
| Antibody | 0hits |
Gene Mutants - List
Search Condition : (Keyword = entA b0596 ECK0589 JW0588)
12hits
First Previous 1-10 11-12 Next Last All| ME No. | Strain Name | Sex | Genotype | Other Remarks | Gene Mutants Detail Info | Request |
|---|---|---|---|---|---|---|
| JE7495 | EntA+5#14 | F- |
thi leu proC trpE supE4 |
|
||
| JE7531 | EntA+lip+2 | F- |
thi leu proC trpE supE4 |
|
||
| JE7533 | EntA+lip-3 | F- |
lip-9 thi leu proC trpE supE4 |
|
||
| JE7523 | LeuS+ent-7 | F- | entA thy str deoC |
|
||
| JE7525 | RodA+ent-1 | F- |
entA sup-1 |
|
||
| JE7529 | Lip+ent-7 | F- | entA thi his proA purB mtl xyl galK lacY str supE |
|
||
| JE7513 | 7 | F- |
dacA1 |
|
||
| JE7515 | 9 | F- |
thi leu proC trpE supE4 |
|
||
| ME8450 | RK4342,CGSC6402 | F- |
pro-3 DE(la |
zbc-601::Tn10 is close to entA. Deletion 6 is the allele lac72 of Lederberg strain W4032,a deletion of the entire lac operon.
|
||
| JE7348 | ? | ara leu azi tonA lacY entA trp str xyl mtl thi |
|
Culture Condition - List
Search Condition : (Keyword = entA b0596 ECK0589 JW0588)
1hits
First Previous 1-1 Next Last All| Gene Symbol | Mnemonic | Synonyms |
|---|---|---|
| entA | enterochelin |
ASKA Clone(-) - List
Search Condition : (Keyword = entA b0596 ECK0589 JW0588)
1hits
First Previous 1-1 Next Last All
Resource No (JW ID)
 |
Gene Name
|
Primer Sequence for N terminal | Primer Sequence for C terminal | Comment | Request |
|---|---|---|---|---|---|
| JW0588-AM | entA | GCCGATTTCAGCGGTAAAAATGT | CCTGCCCCCAGCGTTGAGCCGCC | Clone OK |
ASKA Clone(+) - List
Search Condition : (Keyword = entA b0596 ECK0589 JW0588)
1hits
First Previous 1-1 Next Last All|
Resource No (JW ID)
|
Gene Name
|
Primer Sequence for N terminal | Primer Sequence for C terminal | Comment | Request |
|---|---|---|---|---|---|
| JW0588-AP | entA | GCCGATTTCAGCGGTAAAAATGT | CCTGCCCCCAGCGTTGAGCCGCC | Clone OK |
Gateway Entry Clone library - List
Search Condition : (Keyword = entA b0596 ECK0589 JW0588)
1hits
First Previous 1-1 Next Last All|
Resource No (JW ID)
|
Gene Name
|
Clone verification class | Cloning Method | Request |
|---|---|---|---|---|
| JW0588-GE | entA | A | ASKA to pDONR/zeo |
Mobile Plasmid Collection - List
Search Condition : (Keyword = entA b0596 ECK0589 JW0588)
1hits
First Previous 1-1 Next Last All| Accession No | ORF No.(Japan) | ORF No.(USA) | Gene Name | Length | Source | Plasmid | Request |
|---|---|---|---|---|---|---|---|
| 565 | 165#11 | b0596 | entA | 747 | pNTR-SD |
Keio Collection - List
Search Condition : (Keyword = entA b0596 ECK0589 JW0588)
1hits
First Previous 1-1 Next Last All|
Resource No (JW ID)
|
Gene Name
|
Comment |
Cell Shape |
Cell Shape Image | Request |
|---|---|---|---|---|---|
| JW0588-KC | entA | ready to distribute | Normal |
 |
