ASKA Clone(+) - Detail

Resource No (JW ID) genobase.gif JW1875-AP
Gene Name  tar
Primer Sequence for N terminal GCCATTAACCGTATCCGCGTAGT
Primer Sequence for C terminal CCAAATGTTTCCCAGTTTGGATC
Comment Clone OK
Reference Sekar K, Linker SM, Nguyen J, Grünhagen A, Stocker R, Sauer U.
Bacterial Glycogen Provides Short-Term Benefits in Changing Environments.
Appl Environ Microbiol  (2020)  86(9)  
[PubMed ID = 32111592]  [RRC reference
Related Pathways
Updated:2023/07/16
ecj02020 Two-component system
ecj02030 Bacterial chemotaxis
Request
page-top
/ecoli/strain