This page requires JavaScript to function properly. Please enable JavaScript in your browser to view this page.

ASKA Clone(-) - Detail

Resource No (JW ID)		JW2581-AM
Gene Name		tyrA
Primer Sequence for N terminal		GCCGTTGCTGAATTGACCGCATT
Primer Sequence for C terminal		CCtTGGCGATTGTCATTCGCCTG
Comment		Clone OK
Reference
Related Pathways Updated:2023/07/16		ecj00400 Phenylalanine, tyrosine and tryptophan biosynthesis ecj00401 Novobiocin biosynthesis ecj01100 Metabolic pathways ecj01110 Biosynthesis of secondary metabolites ecj01230 Biosynthesis of amino acids
Request

Address:
National Institute of Genetics, Microbial Physiology Laboratory, NBRP E. coli
1111 Yata, Mishima, Shizuoka, 411-8540 JAPAN
e-mail:

NIKI Hironori

/ecoli/strain