ASKA Clone(-) - Detail

Resource No (JW ID) genobase.gif JW2424-AM
Gene Name  yfeX
Primer Sequence for N terminal GCCTCTCAGGTTCAGAGTGGCAT
Primer Sequence for C terminal CCaAGCGCCATCAACTTGTCCAG
Comment Clone OK
Reference
Request
page-top
/ecoli/strain