ASKA Clone(-) - Detail

Resource No (JW ID) genobase.gif JW0001-AM
Gene Name  thrA
Primer Sequence for N terminal GCCCGAGTGTTGAAGTTCGGCGG
Primer Sequence for C terminal CCGACTCCTAACTTCCATGAGAG
Comment Clone OK
Reference
Related Pathways
Updated:2023/07/16		 ecj00260 Glycine, serine and threonine metabolism
ecj00261 Monobactam biosynthesis
ecj00270 Cysteine and methionine metabolism
ecj00300 Lysine biosynthesis
ecj01100 Metabolic pathways
ecj01110 Biosynthesis of secondary metabolites
ecj01120 Microbial metabolism in diverse environments
ecj01230 Biosynthesis of amino acids
Request
page-top
/ecoli/strain