ASKA Clone(-) - Detail

Resource No (JW ID) genobase.gif JW0622-AM
Gene Name  tatE
Primer Sequence for N terminal GCCGGTGAGATTAGTATTACCAA
Primer Sequence for C terminal CCCTCTTTATGAGAGAGCTTTTC
Comment Clone OK
Reference
Request
page-top
/ecoli/strain