Notice: Suspension of Services Because of the Relocation of Communication Equipment Due to River Construction in the Prefecture

For the relocation of communication equipment due to river construction in the prefecture, services on our website will be suspended about 60 minutes during the period of time stated below. We apologize for the inconvenience and we thank you for your understanding in this matter.

Thu. 16th Dec. 2021 04:00 - 06:00 (JST)

ASKA Clone(-) - Detail

Resource No (JW ID) genobase.gif JW0622-AM
Gene Name  tatE
Primer Sequence for N terminal GCCGGTGAGATTAGTATTACCAA
Primer Sequence for C terminal CCCTCTTTATGAGAGAGCTTTTC
Comment Clone OK