ASKA Clone(+) - Detail

Resource No (JW ID) genobase.gif JW4362-AP
Gene Name  creC
Primer Sequence for N terminal GCCCGTATCGGCATGCGGTTGTT
Primer Sequence for C terminal CCTGTGAAGTGACGGTGAAGTCG
Comment Clone OK