Notice: Suspension of Services Due to the Network maintenance work of NIG

The services on our website will be stopped during the period of time stated below due to the network maintenance work of NIG. We apologize for the inconvenience and we thank you for your understanding in this matter.

Sat. 6th Jun. 2020 8:30 -17:30

ASKA Clone(+) - Detail

Resource No (JW ID) genobase.gif JW3882-AP
Gene Name  cpxA
Primer Sequence for N terminal GCCATAGGCAGCTTAACCGCGCG
Primer Sequence for C terminal CCACTCCGCTTATACAGCGGCAA
Comment Clone OK
Reference
Request
page-top
/ecoli/strain