ASKA Clone(+) - Detail

Resource No (JW ID) genobase.gif JW0658-AP
Gene Name  miaB
Primer Sequence for N terminal GCCACCAAAAAACTCCATATTAA
Primer Sequence for C terminal CCCGGCTGATAATAACCCACGCC
Comment Clone OK
Reference
Request
page-top
/ecoli/strain