ASKA Clone(+) - Detail

Resource No (JW ID) genobase.gif JW0049-AP
Gene Name  apaG
Primer Sequence for N terminal GCCATCAATTCGCCCCGAGTGTG
Primer Sequence for C terminal CCATGAATGAGTGTGGGAACGGC
Comment Clone OK
Reference
Request
page-top
/ecoli/strain