Notice: Suspension of Services Due to the Server maintenance work of NIG

The services on our website will be stopped during the period of time stated below due to the server maintenance work of NIG. We apologize for the inconvenience and we thank you for your understanding in this matter.

Thu. 26th Nov. 2020 18:00 - Sun. 29th Nov. 2020 12:00

ASKA Clone(+) - Detail

Resource No (JW ID) genobase.gif JW0039-AP
Gene Name  caiT
Primer Sequence for N terminal GCCAAGAATGAAAAGAGAAAAAC
Primer Sequence for C terminal CCATCTTTCCAGTTCTGTTTCGC
Comment Clone OK
Reference
Request
page-top
/ecoli/strain