ASKA Clone(+) - Detail

Resource No (JW ID) genobase.gif JW0029-AP
Gene Name  dapB
Primer Sequence for N terminal GCCCATGATGCAAACATCCGCGT
Primer Sequence for C terminal CCCAAATTATTGAGATCAAGTAC
Comment Clone OK