ASKA Clone(+) - Detail

Resource No (JW ID) genobase.gif JW0003-AP
Gene Name  thrC
Primer Sequence for N terminal GCCAAACTCTACAATCTGAAAGA
Primer Sequence for C terminal CCCTGATGATTCATCATCAATTT
Comment Clone OK
Reference
Related Pathways
Updated:2023/07/16		 ecj00260 Glycine, serine and threonine metabolism
ecj00750 Vitamin B6 metabolism
ecj01100 Metabolic pathways
ecj01110 Biosynthesis of secondary metabolites
ecj01120 Microbial metabolism in diverse environments
ecj01230 Biosynthesis of amino acids
Request
page-top
/ecoli/strain