mutation predictions | marginal predictions | summary statistics | genome diff | command line log
|
breseq version 0.39.0
mutation predictions | marginal predictions | summary statistics | genome diff | command line log |
| Predicted mutations | |||||
|---|---|---|---|---|---|
| evidence | position | mutation | annotation | gene | description |
| MC JC | 255,892 | Δ18,063 bp | IS5‑mediated | gpt–[ykfC] | 26 genes gpt, frsA, crl, insB9, insA9, crl, phoE, proB, proA, thrW, ykfI, yafW, ykfH, ykfG, yafX, ykfF, ykfB, yafY, yafZ, ykfA, perR, insN, insI1, insN, eyeA, [ykfC] |
| RA | 284,535 | T→G | A445A (GCT→GCG) | yagF → | D‑xylonate dehydratase |
| RA | 292,019 | C→T | L174L (CTA→TTA) | yagJ → | protein YagJ |
| RA | 309,381 | C→T | D216N (GAT→AAT) | ecpB ← | putative fimbrial chaperone EcpB |
| RA | 309,985 | T→A | G14G (GGA→GGT) | ecpB ← | putative fimbrial chaperone EcpB |
| RA | 321,260 | A→T | intergenic (+179/‑348) | rclR → / → ykgE | DNA‑binding transcriptional activator RclR/putative lactate utilization oxidoreductase YkgE |
| JC JC | 362,204 | IS1 (–) +9 bp | coding (968‑976/1254 nt) | lacY ← | lactose permease |
| RA | 410,666 | C→T | P175S (CCT→TCT) | mak → | fructokinase |
| RA | 421,027 | C→T | R14R (CGC→CGT) | proY → | putative transporter ProY |
| RA | 431,912 | C→T | W34* (TGG→TGA) | tsx ← | nucleoside‑specific channel‑forming protein Tsx |
| RA | 465,005 | G→A | V181V (GTC→GTT) | queC ← | 7‑cyano‑7‑deazaguanine synthase |
| RA | 472,849 | A→G | G84G (GGA→GGG) | glnK → | nitrogen regulatory protein PII‑2 |
| RA | 495,622 | C→T | T168I (ACC→ATC) | htpG → | chaperone protein HtpG |
| RA | 690,948 | G→A | V279V (GTC→GTT) | ybeX ← | CorC‑HlyC family protein YbeX |
| RA | 700,038 | G→A | H97Y (CAT→TAT) | umpH ← | UMP phosphatase |
| RA | 792,018 | C→T | G13E (GGA→GAA) | galE ← | UDP‑glucose 4‑epimerase |
| RA | 809,217 | 2 bp→AG | coding (40‑41/1290 nt) | bioA ← | adenosylmethionine‑8‑amino‑7‑oxononanoate aminotransferase |
| RA | 868,422 | (C)8→7 | coding (903/1872 nt) | gsiA → | glutathione ABC transporter ATP binding subunit GsiA |
| RA | 968,837 | G→A | D158N (GAT→AAT) | lpxK → | tetraacyldisaccharide 4'‑kinase |
| RA | 1,040,126 | G→T | L277L (CTG→CTT) | appB → | cytochrome bd‑II subunit 2 |
| RA | 1,061,935 | G→A | S46N (AGC→AAC) | torD → | trimethylamine‑N‑oxide reductase‑specific chaperone |
| RA | 1,069,743 | C→T | A33T (GCA→ACA) | rutG ← | pyrimidine:H(+) symporter |
| RA | 1,098,620 | T→A | V245V (GTT→GTA) | ghrA → | glyoxylate/hydroxypyruvate reductase A |
| RA | 1,111,727 | 2 bp→TT | coding (865‑866/2544 nt) | opgH → | osmoregulated periplasmic glucans biosynthesis protein H |
| RA | 1,169,836 | A→G | L180P (CTG→CCG) | ldtC ← | L,D‑transpeptidase LdtC |
| RA | 1,189,980 | A→G | T156T (ACT→ACC) | phoP ← | DNA‑binding transcriptional dual regulator PhoP |
| RA | 1,196,220 | C→T | H366H (CAC→CAT) | icd → | isocitrate dehydrogenase |
| RA | 1,196,232 | C→T | T370T (ACC→ACT) | icd → | isocitrate dehydrogenase |
| RA | 1,196,245 | T→C | L375M (TTA→CTG) | icd → | isocitrate dehydrogenase |
| RA | 1,196,247 | A→G | L375M (TTA→CTG) | icd → | isocitrate dehydrogenase |
| RA | 1,299,457 | G→A | intergenic (+212/‑110) | ychE → / → insH21 | MarC family putative inner membrane protein YchE/IS5 family transposase and trans‑activator |
| RA | 1,301,992 | A→T | N271Y (AAT→TAT) | oppA → | oligopeptide ABC transporter periplasmic binding protein |
| RA | 1,306,736 | T→G | S325A (TCC→GCC) | oppF → | murein tripeptide ABC transporter/oligopeptide ABC transporter ATP binding subunit OppF |
| RA | 1,310,770 | A→G | H32H (CAT→CAC) | yciI ← | protein YciI |
| RA | 1,337,394 | A→G | S522G (AGC→GGC) | acnA → | aconitate hydratase 1 |
| RA | 1,357,202 | C→T | intergenic (‑92/+221) | sapA ← / ← ymjA | putative periplasmic binding protein SapA/DUF2543 domain‑containing protein YmjA |
| RA | 1,358,859 | T→C | Y110C (TAT→TGT) | puuP ← | putrescine:H(+) symporter PuuP |
| MC JC | 1,411,925 | Δ23,060 bp | [ttcA]–ynaM | 34 genes [ttcA], intR, xisR, rcbA, ralA, ralR, recT, recE, racC, ydaE, kilR, kilS, sieB, ydaF, ydaG, racR, ydaS, ydaT, ydaU, ydaV, ydaW, rzoR, trkG, ynaK, ydaY, ynaA, lomR, insH5, lomR, stfR, tfaR, pinR, ynaE, ynaM |
|
| JC JC | 1,589,976 | IS2 (+) +5 bp | coding (22‑26/1149 nt) | ydeT ← | fimbrial usher domain‑containing protein YdeT |
| RA | 1,591,711 | C→A | E156* (GAG→TAG) | hipA ← | serine/threonine‑protein kinase toxin HipA |
| RA | 1,629,247 | C→T | I11I (ATC→ATT) | ydfZ → | putative selenoprotein YdfZ |
| RA | 1,643,679 | A→T | L209Q (CTG→CAG) | ydfU ← | protein YdfU |
| RA | 1,652,331 | T→C | intergenic (+2346/+397) | ydfD → / ← ynfP | lysis protein/protein YnfP |
| RA | 1,660,102 | C→T | N678N (AAC→AAT) | ynfE → | putative selenate reductase YnfE |
| RA | 1,667,460 | G→A | Q369* (CAG→TAG) | mlc ← | DNA‑binding transcriptional repressor Mlc |
| RA | 1,712,661 | A→T | intergenic (+503/‑108) | nth → / → dtpA | endonuclease III/dipeptide/tripeptide:H(+) symporter DtpA |
| JC | 1,743,618 | (TATCTGG)1→2 | coding (162/1374 nt) | mdtK → | multidrug efflux pump MdtK |
| RA | 1,748,841 | C→T | R240K (AGA→AAA) | ydhT ← | uncharacterized protein YdhT |
| RA | 1,836,397 | G→A | E109K (GAG→AAG) | ynjB → | putative ABC transporter periplasmic binding protein YnjB |
| RA | 1,848,300 | 2 bp→TT | coding (376‑377/552 nt) | ydjA ← | putative oxidoreductase YdjA |
| RA | 1,877,776 | G→A | S21N (AGT→AAT) | dgcP → | diguanylate cyclase DgcP |
| RA | 1,894,839 | T→C | L12P (CTC→CCC) | pabB → | aminodeoxychorismate synthase subunit 1 |
| RA | 2,040,433 | C→A | A319D (GCC→GAC) | msrP → | protein‑L‑methionine sulfoxide reductase catalytic subunit MsrP |
| RA | 2,040,618 | T→A | F46I (TTT→ATT) | msrQ → | membrane‑bound flavocytochrome MsrQ |
| RA | 2,173,363 | Δ2 bp | intergenic (‑490/+918) | gatD ← / ← gatB | galactitol‑1‑phosphate 5‑dehydrogenase/galactitol‑specific PTS enzyme IIB component |
| RA | 2,173,448 | C→T | intergenic (‑575/+834) | gatD ← / ← gatB | galactitol‑1‑phosphate 5‑dehydrogenase/galactitol‑specific PTS enzyme IIB component |
| RA | 2,188,087 | T→C | T110A (ACG→GCG) | yehA ← | putative fimbrial adhesin YehA |
| RA | 2,233,609 | C→T | Q4* (CAG→TAG) | yeiS → | DUF2542 domain‑containing protein YeiS |
| JC JC | 2,239,316 | IS5 (–) +4 bp | intergenic (‑27/+31) | mglA ← / ← mglB | D‑galactose/methyl‑galactoside ABC transporter ATP binding subunit/D‑galactose/methyl‑galactoside ABC transporter periplasmic binding protein |
| RA | 2,242,247 | C→T | G241R (GGG→AGG) | yeiB ← | DUF418 domain‑containing protein YeiB |
| RA | 2,247,134 | A→C | Y467D (TAC→GAC) | lysP ← | lysine:H(+) symporter |
| RA | 2,259,422 | A→C | intergenic (‑126/+297) | psuK ← / ← fruA | putative pseudouridine kinase/fructose‑specific PTS multiphosphoryl transfer protein FruA |
| RA | 2,287,156 | G→A | pseudogene (1759/2525 nt) | yejO ← | adhesin‑like autotransporter YejO |
| RA | 2,290,958 | G→A | V153V (GTG→GTA) | narP → | DNA‑binding transcriptional dual regulator NarP |
| RA | 2,298,120 | C→T | G47E (GGG→GAG) | napC ← | periplasmic nitrate reductase cytochrome c protein |
| RA | 2,303,361 | G→A | A46V (GCT→GTT) | napF ← | ferredoxin‑type protein |
| RA | 2,303,536 | G→A | intergenic (‑39/‑70) | napF ← / → yojO | ferredoxin‑type protein/uncharacterized protein YojO |
| RA | 2,308,979 | G→A | R121R (CGC→CGT) | alkB ← | DNA oxidative demethylase |
| RA | 2,317,631 | G→A | T749I (ACT→ATT) | rcsC ← | histidine kinase RcsC |
| RA | 2,322,998 | G→A | G378D (GGC→GAC) | atoC → | DNA‑binding transcriptional activator/ornithine decarboxylase inhibitor AtoC |
| RA | 2,327,092 | G→A | G328G (GGG→GGA) | atoB → | acetyl‑CoA acetyltransferase |
| RA | 2,329,835 | G→A | intergenic (‑38/+4501) | yfaQ ← / ← yfaT | tandem DUF2300 domain‑containing protein YfaQ/DUF1175 domain‑containing protein YfaT |
| RA | 2,330,112 | G→A | intergenic (‑315/+4224) | yfaQ ← / ← yfaT | tandem DUF2300 domain‑containing protein YfaQ/DUF1175 domain‑containing protein YfaT |
| RA | 2,344,839 | G→A | intergenic (‑102/‑26) | ypaB ← / → nrdA | protein YpaB/ribonucleoside‑diphosphate reductase 1 subunit alpha |
| RA | 2,347,837 | G→A | E152K (GAA→AAA) | nrdB → | ribonucleoside‑diphosphate reductase 1 subunit beta |
| RA | 2,380,248 | G→A | S132S (TCC→TCT) | menF ← | isochorismate synthase MenF |
| RA | 2,404,402 | G→A | S71L (TCG→TTG) | nuoB ← | NADH:quinone oxidoreductase subunit B |
| RA | 2,481,608 | A→G | L190S (TTA→TCA) | emrY ← | tripartite efflux pump membrane subunit EmrY |
| RA | 2,498,392 | A→C | intergenic (‑97/‑279) | alaC ← / → pyrS | glutamate‑‑pyruvate aminotransferase AlaC/sensor histidine kinase PyrS |
| RA | 2,546,804 | T→A | D44E (GAT→GAA) | murP → | N‑acetylmuramic acid‑specific PTS enzyme IICB component/anhydro‑N‑acetylmuramic acid transporter |
| MC JC | 2,558,699 | Δ6,790 bp | intZ–[eutA] | intZ, yffL, yffM, yffN, yffO, yffP, yffQ, yffR, yffS, [eutA] | |
| RA | 2,577,937 | T→C | E147E (GAA→GAG) | maeB ← | malate dehydrogenase (oxaloacetate‑decarboxylating) (NADP(+)) |
| RA | 2,587,112 | C→T | A461V (GCA→GTA) | narQ → | sensor histidine kinase NarQ |
| RA | 2,745,600 | A→G | Y107H (TAC→CAC) | rimM ← | ribosome maturation factor RimM |
| RA | 2,774,947 | G→A | G544S (GGT→AGT) | yfjW → | uncharacterized protein YfjW |
| RA | 2,861,385 | T→C | intergenic (‑151/‑45) | ygbI ← / → ygbJ | DNA‑binding transcriptional repressor YgbI/putative L‑threonate dehydrogenase |
| RA | 2,867,455 | G→A | Q33* (CAG→TAG) | rpoS ← | RNA polymerase sigma factor RpoS |
| RA | 2,880,635 | T→C | L138L (TTA→TTG) | casD ← | type I‑E CRISPR system Cascade subunit CasD |
| RA | 2,926,772 | C→A | G155G (GGC→GGA) | ppnN → | nucleotide 5'‑monophosphate nucleosidase |
| RA | 3,025,601 | (T)5→4 | coding (1251/1401 nt) | xanQ → | xanthine:H(+) symporter XanQ |
| RA | 3,070,858 | T→G | K129N (AAA→AAC) | fbaA ← | fructose‑bisphosphate aldolase class II |
| MC JC | 3,131,341 | Δ128 bp | IS5‑mediated | yghQ ← | putative transport protein YghQ |
| RA | 3,207,549 | Δ1 bp | coding (179/606 nt) | ttdB → | L(+)‑tartrate dehydratase subunit beta |
| RA | 3,256,301 | G→A | S117S (TCC→TCT) | cyuA ← | putative L‑cysteine desulfidase CyuA |
| RA | 3,279,276 | C→G | F121L (TTC→TTG) | kbaZ → | putative tagatose‑1,6‑bisphosphate aldolase 1 chaperone |
| RA | 3,296,481 | G→A | V25M (GTG→ATG) | dolP → | division and outer membrane stress‑associated lipid‑binding lipoprotein |
| RA | 3,329,743 | G→T | D261Y (GAT→TAT) | dacB → | peptidoglycan DD‑endopeptidase DacB |
| RA | 3,388,041 | T→G | T50P (ACG→CCG) | aaeB ← | aromatic carboxylic acid efflux pump subunit AaeB |
| RA | 3,411,689 | G→T | E13* (GAA→TAA) | yhdJ → | DNA adenine methyltransferase |
| RA | 3,433,900 | C→T | L71L (CTA→TTA) | def → | peptide deformylase |
| RA | 3,444,904 | C→T | G109D (GGT→GAT) | rpsE ← | 30S ribosomal subunit protein S5 |
| RA | 3,448,235 | C→A | intergenic (‑86/+79) | rplN ← / ← rpsQ | 50S ribosomal subunit protein L14/30S ribosomal subunit protein S17 |
| RA | 3,474,425 | T→G | K43T (AAA→ACA) | rpsL ← | 30S ribosomal subunit protein S12 |
| RA | 3,486,175 | G→A | C19Y (TGC→TAC) | crp → | DNA‑binding transcriptional dual regulator CRP |
| RA | 3,486,502 | C→T | T128I (ACT→ATT) | crp → | DNA‑binding transcriptional dual regulator CRP |
| RA | 3,507,249 | C→T | D30N (GAC→AAC) | yhfT ← | uncharacterized protein YhfT |
| RA | 3,511,466 | C→T | V293V (GTG→GTA) | yhfZ ← | putative DNA‑binding transcriptional regulator YhfZ |
| RA | 3,555,047 | 2 bp→TG | coding (1963‑1964/2706 nt) | malT → | DNA‑binding transcriptional activator MalT |
| RA | 3,560,362 | G→A | intergenic (+496/+260) | rtcR → / ← glpG | DNA‑binding transcriptional activator RtcR/rhomboid protease GlpG |
| RA | 3,560,455 | +G | intergenic (+589/+167) | rtcR → / ← glpG | DNA‑binding transcriptional activator RtcR/rhomboid protease GlpG |
| RA | 3,646,970 | G→T | Q224H (CAG→CAT) | gor → | glutathione reductase (NADPH) |
| RA | 3,647,428 | C→T | A377V (GCG→GTG) | gor → | glutathione reductase (NADPH) |
| RA | 3,675,661 | G→A | W292* (TGG→TGA) | yhjE → | putative transporter YhjE |
| RA | 3,679,581 | G→A | G55R (GGA→AGA) | kdgK → | 2‑dehydro‑3‑deoxygluconokinase |
| RA | 3,707,947 | C→A | intergenic (‑242/+669) | dppA ← / ← proK | dipeptide ABC transporter periplasmic binding protein/tRNA‑Pro |
| RA | 3,719,429 | G→A | intergenic (‑385/‑49) | yiaF ← / → yiaG | DUF3053 domain‑containing protein YiaF/putative DNA‑binding transcriptional regulator YiaG |
| RA | 3,725,176 | T→G | E48A (GAG→GCG) | glyQ ← | glycine‑‑tRNA ligase subunit alpha |
| RA | 3,729,440 | 2 bp→TT | noncoding (105‑106/160 nt) | xylZ ← | small RNA XylZ |
| RA | 3,730,560 | C→T | W69* (TGG→TAG) | xylA ← | xylose isomerase |
| RA | 3,770,539 | C→T | V281M (GTG→ATG) | yibH ← | inner membrane protein YibH |
| RA | 3,773,173 | Δ1 bp | coding (893/1914 nt) | mtlA → | mannitol‑specific PTS enzyme IICBA component |
| RA | 3,773,176 | C→T | S299F (TCT→TTT) | mtlA → | mannitol‑specific PTS enzyme IICBA component |
| RA | 3,797,240 | C→T | P98L (CCA→CTA) | waaL → | O‑antigen ligase |
| RA | 3,815,525 | C→T | A82T (GCT→ACT) | pyrE ← | orotate phosphoribosyltransferase |
| RA | 3,815,883 | +C | coding (667/687 nt) | rph ← | truncated RNase PH |
| RA | 3,817,167 | C→T | T164T (ACC→ACT) | yicC → | putative RNase adaptor protein YicC |
| RA | 3,819,235 | C→T | A121V (GCG→GTG) | yicG → | PF03458 family inner membrane protein YicG |
| RA | 3,821,255 | C→T | intergenic (‑85/‑173) | ligB ← / → gmk | DNA ligase B/guanylate kinase |
| RA | 3,821,763 | C→T | R112R (CGC→CGT) | gmk → | guanylate kinase |
| RA | 3,829,822 | C→T | S293F (TCT→TTT) | xanP → | xanthine:H(+) symporter XanP |
| RA | 3,853,815 | C→T | R9K (AGG→AAG) | ysdE ← | protein YsdE |
| RA | 3,863,558 | C→T | V16M (GTG→ATG) | glvC ← | putative PTS enzyme II component GlvC |
| RA | 3,870,203 | G→A | G276E (GGA→GAA) | cbrA → | colicin M resistance protein |
| RA | 3,874,533 | C→T | A210T (GCA→ACA) | dgoR ← | DNA‑binding transcriptional regulator DgoR |
| RA | 3,875,258 | C→T | intergenic (‑98/‑180) | dgoR ← / → yidX | DNA‑binding transcriptional regulator DgoR/putative lipoprotein YidX |
| RA | 3,901,103 | C→T | G373D (GGC→GAC) | bglH ← | carbohydrate‑specific outer membrane porin, cryptic |
| RA | 3,901,242 | C→T | D327N (GAT→AAT) | bglH ← | carbohydrate‑specific outer membrane porin, cryptic |
| RA | 3,910,838 | C→T | A230T (GCG→ACG) | pstS ← | phosphate ABC transporter periplasmic binding protein |
| RA | 3,925,200 | T→C | K145R (AAG→AGG) | mnmG ← | 5‑carboxymethylaminomethyluridine‑tRNA synthase subunit MnmG |
| RA | 3,926,991 | G→A | L5L (CTG→TTG) | asnC ← | DNA‑binding transcriptional dual regulator AsnC |
| JC | 3,930,852 | (TTAGCGCCTGAATAGAAAGGGGACCAAAAACTT)1→2 | coding (242/1497 nt) | ravA ← | regulatory ATPase RavA |
| RA | 3,931,779 | T→C | F155S (TTT→TCT) | kup → | K(+):H(+) symporter Kup |
| RA | 3,932,631 | C→T | T439I (ACC→ATC) | kup → | K(+):H(+) symporter Kup |
| RA | 3,934,681 | C→T | L302L (CTA→TTA) | rbsA → | ribose ABC transporter ATP binding subunit |
| RA | 3,941,085 | C→T | S81S (TCG→TCA) | yieP ← | DNA‑binding transcriptional regulator YieP |
| RA | 3,946,718 | C→T | noncoding (19/120 nt) | rrfC → | 5S ribosomal RNA |
| RA | 3,946,769 | C→T | noncoding (70/120 nt) | rrfC → | 5S ribosomal RNA |
| RA | 3,957,072 | C→T | S250N (AGC→AAC) | ilvY ← | DNA‑binding transcriptional dual regulator IlvY |
| RA | 3,961,093 | C→T | I139I (ATC→ATT) | rep → | ATP‑dependent DNA helicase Rep |
| RA | 3,964,871 | C→T | E254K (GAG→AAG) | rhlB ← | ATP‑dependent RNA helicase RhlB |
| RA | 3,966,530 | 2 bp→TT | coding (114‑115/1260 nt) | rho → | transcription termination factor Rho |
| RA | 3,983,324 | C→T | H123Y (CAT→TAT) | aslB → | putative anaerobic sulfatase maturation enzyme AslB |
| RA | 3,983,656 | C→T | R233R (CGC→CGT) | aslB → | putative anaerobic sulfatase maturation enzyme AslB |
| RA | 4,000,793 | C→T | A88A (GCG→GCA) | yigE ← | DUF2233 domain‑containing protein YigE |
| RA | 4,008,343 | C→T | A196V (GCC→GTC) | rhtC → | L‑threonine exporter |
| RA | 4,025,488 | C→T | R167R (CGC→CGT) | ubiD → | 3‑octaprenyl‑4‑hydroxybenzoate decarboxylase |
| RA | 4,054,687 | C→T | A198T (GCA→ACA) | glnG ← | DNA‑binding transcriptional dual regulator NtrC |
| RA | 4,065,065 | C→T | R234R (CGG→CGA) | yihO ← | putative sulfoquinovose transporter |
| RA | 4,070,749 | C→T | Q336Q (CAG→CAA) | yihS ← | sulfoquinovose isomerase |
| RA | 4,075,529 | C→T | intergenic (+75/‑24) | csqR → / → yihX | DNA‑binding transcriptional dual regulator CsqR/alpha‑D‑glucose‑1‑phosphate phosphatase YihX |
| RA | 4,076,171 | C→T | A9V (GCC→GTC) | yihY → | PF03631 family membrane protein YihY |
| RA | 4,080,540 | C→T | S230N (AGC→AAC) | fdhE ← | formate dehydrogenase formation protein |
| RA | 4,095,231 | C→T | S251N (AGC→AAC) | rhaA ← | L‑rhamnose isomerase |
| RA | 4,119,383 | C→T | intergenic (‑53/+40) | rraA ← / ← menA | ribonuclease E inhibitor protein A/1,4‑dihydroxy‑2‑naphthoate octaprenyltransferase |
| RA | 4,122,884 | C→T | T152T (ACG→ACA) | ftsN ← | cell division protein FtsN |
| RA | 4,143,840 | C→T | R73C (CGT→TGT) | frwB → | putative PTS enzyme IIB component FrwB |
| RA | 4,153,836 | G→A | Q338* (CAA→TAA) | argE ← | acetylornithine deacetylase |
| RA | 4,175,833 | C→T | intergenic (+4/‑111) | thrT → / → tufB | tRNA‑Thr/translation elongation factor Tu 2 |
| RA | 4,177,286 | C→T | intergenic (+158/‑72) | tufB → / → secE | translation elongation factor Tu 2/Sec translocon subunit SecE |
| RA | 4,185,595 | C→T | G82G (GGC→GGT) | rpoC → | RNA polymerase subunit beta' |
| RA | 4,191,740 | C→T | M43I (ATG→ATA) | thiH ← | 2‑iminoacetate synthase |
| RA | 4,193,996 | T→G | D70A (GAT→GCT) | thiE ← | thiamine phosphate synthase |
| RA | 4,215,670 | G→T | D65Y (GAT→TAT) | aceB → | malate synthase A |
| RA | 4,219,353 | C→T | A253V (GCG→GTG) | aceK → | isocitrate dehydrogenase kinase/phosphatase |
| RA | 4,219,957 | C→T | F454F (TTC→TTT) | aceK → | isocitrate dehydrogenase kinase/phosphatase |
| RA | 4,223,638 | T→C | intergenic (‑10/‑190) | iclR ← / → metH | DNA‑binding transcriptional repressor IclR/cobalamin‑dependent methionine synthase |
| RA | 4,247,444 | C→T | L221L (CTG→TTG) | malK → | maltose ABC transporter ATP binding subunit |
| RA | 4,272,686 | C→T | E396K (GAA→AAA) | uvrA ← | UvrABC excision nuclease subunit A |
| RA | 4,296,381 | +GC | intergenic (+587/+55) | gltP → / ← yjcO | glutamate/aspartate : H(+) symporter GltP/Sel1 repeat‑containing protein YjcO |
| RA | 4,325,644 | C→T | S33N (AGC→AAC) | yjdN ← | PF06983 family protein YjdN |
| RA | 4,331,890 | C→T | L463L (CTC→CTT) | proP → | osmolyte:H(+) symporter ProP |
| RA | 4,422,864 | C→T | P7S (CCG→TCG) | ulaE → | L‑ribulose‑5‑phosphate 3‑epimerase UlaE |
| RA | 4,437,890 | C→T | Q62* (CAG→TAG) | ytfI → | protein YtfI |
| RA | 4,473,900 | C→T | G52R (GGA→AGA) | bdcA ← | c‑di‑GMP‑binding biofilm dispersal mediator protein |
| RA | 4,475,493 | T→C | F19F (TTT→TTC) | yjgL → | protein YjgL |
| RA | 4,476,605 | G→A | S390N (AGC→AAC) | yjgL → | protein YjgL |
| RA | 4,489,016 | C→T | E350K (GAA→AAA) | yjgR ← | DUF853 domain‑containing protein YjgR |
| RA | 4,510,238 | T→G | intergenic (+445/+452) | insO → / ← fecE | IS911B regulator fragment/ferric citrate ABC transporter ATP binding subunit |
| RA | 4,532,409 | T→G | intergenic (‑758/+28) | sgcX ← / ← yjhP | putative endoglucanase with Zn‑dependent exopeptidase domain/putative methyltransferase YjhP |
| RA | 4,546,601 | C→T | I502I (ATC→ATT) | fimD → | type I fimbriae usher protein |
| RA | 4,636,925 | G→C | R77P (CGC→CCC) | creC → | sensory histidine kinase CreC |
| RA | 4,638,240 | G→A | L21L (TTG→TTA) | creD → | putative inner membrane protein CreD |
| Unassigned missing coverage evidence | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| seq id | start | end | size | ←reads | reads→ | gene | description | |||
| * | * | ÷ | NC_000913 | 1196266 | 1211470 | 15205 | 44 [41] | [41] 42 | [icd]–mcrA | [icd],C0293,ymfD,ymfE,lit,intE,xisE,ymfH,ymfI,ymfJ,ymfK,ymfT,ymfL,ymfM,ymfN,ymfR,beeE,ymfQ,ycfK,tfaP,tfaE,pinE,mcrA |
| * | * | ÷ | NC_000913 | 1978495 | 1979270–1978503 | 9–776 | 125 [0] | [0] 153 | insB5–insA5 | insB5,insA5 |
| * | * | ÷ | NC_000913 | 3423806–3424233 | 3424502–3424239 | 7–697 | 42 [40] | [41] 42 | [rrlD] | [rrlD] |
| Unassigned new junction evidence | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
| * | ? | NC_000913 | 273955 = | NA (NA) | 45 (0.410) | 30/598 | 2.9 | 36.9% | noncoding (1195/1195 nt) | IS5 | repeat region |
| ? | NC_000913 | = 674956 | 77 (0.710) | intergenic (‑173/‑62) | leuS/ybeL | leucine‑‑tRNA ligase/DUF1451 domain‑containing protein YbeL | |||||
| * | ? | NC_000913 | 1216131 = | 100 (0.920) | 63 (0.580) | 51/596 | 0.9 | 38.6% | coding (64/273 nt) | ymgA | putative two‑component system connector protein YmgA |
| ? | NC_000913 | 1467910 = | NA (NA) | noncoding (1331/1331 nt) | IS2 | repeat region | |||||
| * | ? | NC_000913 | = 1216135 | 94 (0.860) | 55 (0.500) | 39/598 | 1.9 | 36.9% | coding (68/273 nt) | ymgA | putative two‑component system connector protein YmgA |
| ? | NC_000913 | = 1469240 | NA (NA) | noncoding (1/1331 nt) | IS2 | repeat region | |||||
| * | ? | NC_000913 | = 1299498 | 0 (0.000) | 150 (1.390) | 96/590 | 0.0 | 100% | intergenic (+253/‑69) | ychE/insH21 | MarC family putative inner membrane protein YchE/IS5 family transposase and trans‑activator |
| ? | NC_000913 | 1300698 = | 0 (0.000) | intergenic (+151/‑484) | insH21/oppA | IS5 family transposase and trans‑activator/oligopeptide ABC transporter periplasmic binding protein | |||||
| * | ? | NC_000913 | = 1397238 | NA (NA) | 125 (1.150) | 82/598 | 0.1 | 100% | noncoding (1195/1195 nt) | IS5 | repeat region |
| ? | NC_000913 | = 1978494 | 0 (0.000) | intergenic (‑297/+24) | flhD/insB5 | DNA‑binding transcriptional dual regulator FlhD/IS1 family protein InsB | |||||
| * | ? | NC_000913 | = 1651548 | NA (NA) | 38 (0.350) | 33/594 | 2.5 | 31.7% | noncoding (706/706 nt) | IS2 | repeat region |
| ? | NC_000913 | = 2317418 | 82 (0.760) | coding (2459/2850 nt) | rcsC | histidine kinase RcsC | |||||
| * | ? | NC_000913 | 1978503 = | NA (NA) | 59 (0.540) | 48/598 | 1.1 | 51.3% | noncoding (768/768 nt) | IS1 | repeat region |
| ? | NC_000913 | 3890026 = | 56 (0.510) | coding (1297/1416 nt) | tnaA | tryptophanase | |||||
| * | ? | NC_000913 | 1979271 = | 0 (0.000) | 153 (1.400) | 96/598 | 0.0 | 100% | intergenic (‑56/‑482) | insA5/uspC | IS1 family protein InsA/universal stress protein C |
| ? | NC_000913 | = 2102947 | NA (NA) | pseudogene (443/446 nt) | wbbL | interrupted rhamnosyltransferase WbbL | |||||
| * | ? | NC_000913 | = 2070271 | NA (NA) | 44 (0.400) | 35/598 | 2.3 | 34.1% | noncoding (1/1331 nt) | IS2 | repeat region |
| ? | NC_000913 | 2317414 = | 85 (0.780) | coding (2463/2850 nt) | rcsC | histidine kinase RcsC | |||||
| * | ? | NC_000913 | 3583428 = | NA (NA) | 49 (0.450) | 38/598 | 2.0 | 45.8% | noncoding (1/768 nt) | IS1 | repeat region |
| ? | NC_000913 | = 3890034 | 58 (0.530) | coding (1305/1416 nt) | tnaA | tryptophanase | |||||