mutation predictions | marginal predictions | summary statistics | genome diff | command line log
|
breseq version 0.39.0
mutation predictions | marginal predictions | summary statistics | genome diff | command line log |
| Predicted mutations | |||||
|---|---|---|---|---|---|
| evidence | position | mutation | annotation | gene | description |
| RA | 42,139 | C→A | intergenic (‑208/‑264) | caiT ← / → fixA | L‑carnitine:gamma‑butyrobetaine antiporter/putative electron transfer flavoprotein FixA |
| RA | 44,046 | C→T | P287S (CCG→TCG) | fixB → | putative electron transfer flavoprotein FixB |
| RA | 71,170 | T→C | S262P (TCG→CCG) | araC → | DNA‑binding transcriptional dual regulator AraC |
| RA | 122,288 | G→T | R66L (CGT→CTT) | pdhR → | DNA‑binding transcriptional dual regulator PdhR |
| RA | 154,182 | C→T | L415L (CTG→CTA) | htrE ← | putative fimbrial usher protein HtrE |
| RA | 156,068 | A→G | V45A (GTA→GCA) | yadV ← | putative fimbrial chaperone YadV |
| RA | 246,747 | G→T | S12S (TCG→TCT) | yafL → | NlpC/P60 family protein YafL |
| MC JC | 257,908 | Δ776 bp | insB9–[crl] | insB9, insA9, [crl] | |
| RA | 284,535 | T→G | A445A (GCT→GCG) | yagF → | D‑xylonate dehydratase |
| RA | 313,543 | G→A | intergenic (‑301/‑1748) | ykgR ← / → insE1 | putative membrane protein YkgR/IS3 element protein InsE |
| MC JC | 317,127 | Δ64,133 bp | IS2‑mediated | rclC–[yaiX] | 57 genes rclC, rclB, rclA, rclR, ykgE, ykgF, ykgG, ykgH, betA, betB, betI, betT, yahV, pdeL, yahB, yahC, yahD, yahE, yahF, yahG, yahH, yahI, yahJ, yahK, yahL, yahM, yahN, yahO, prpR, prpB, prpC, prpD, prpE, codB, codA, cynR, cynT, cynS, cynX, lacA, lacY, lacZ, lacI, mhpR, mhpA, mhpB, mhpC, mhpD, mhpF, mhpE, mhpT, yaiL, frmB, frmA, frmR, yaiO, [yaiX] |
| RA | 451,713 | A→G | intergenic (‑103/+357) | cyoA ← / ← ampG | cytochrome bo3 subunit 2/muropeptide:H(+) symporter |
| RA | 480,295 | 2 bp→AA | coding (13‑14/219 nt) | hha ← | hemolysin expression‑modulating protein Hha |
| JC JC | 485,615 | IS2 (+) +5 bp | coding (1‑5/1194 nt) | acrA ← | multidrug efflux pump membrane fusion lipoprotein AcrA |
| RA | 495,622 | C→T | T168I (ACC→ATC) | htpG → | chaperone protein HtpG |
| JC JC | 566,074 | IS3 (+) +3 bp | intergenic (‑96/‑608) | intD ← / → renD | putative integrase/protein RenD |
| JC JC | 571,260 | IS2 (–) +5 bp | coding (368‑372/552 nt) | ybcL → | periplasmic protein YbcL |
| JC JC | 572,157 | IS3 (+) +3 bp | coding (704‑706/798 nt) | ybcM → | putative DNA‑binding transcriptional regulator |
| RA | 578,331 | G→T | A75A (GCG→GCT) R2L (CGA→CTA) |
rzpD → rzoD → |
putative prophage endopeptidase RzpD putative prophage lysis lipoprotein RzoD |
| RA | 578,427 | G→C | T107T (ACG→ACC) R34P (CGG→CCG) |
rzpD → rzoD → |
putative prophage endopeptidase RzpD putative prophage lysis lipoprotein RzoD |
| RA | 578,571 | C→T | intergenic (+3/+29) | rzpD → / ← borD | putative prophage endopeptidase RzpD/prophage lipoprotein BorD |
| RA | 578,574 | A→C | intergenic (+6/+26) | rzpD → / ← borD | putative prophage endopeptidase RzpD/prophage lipoprotein BorD |
| RA | 578,605 | T→G | K97Q (AAA→CAA) | borD ← | prophage lipoprotein BorD |
| RA | 578,729 | A→G | A55A (GCT→GCC) | borD ← | prophage lipoprotein BorD |
| RA | 578,809 | T→C | T29A (ACA→GCA) | borD ← | prophage lipoprotein BorD |
| RA | 578,811 | T→G | Q28P (CAG→CCG) | borD ← | prophage lipoprotein BorD |
| RA | 578,831 | T→C | T21T (ACA→ACG) | borD ← | prophage lipoprotein BorD |
| RA | 579,004 | C→T | intergenic (‑111/+180) | borD ← / ← ybcV | prophage lipoprotein BorD/DUF1398 domain‑containing protein YbcV |
| RA | 579,099 | (A)5→4 | intergenic (‑206/+85) | borD ← / ← ybcV | prophage lipoprotein BorD/DUF1398 domain‑containing protein YbcV |
| RA | 579,127 | T→C | intergenic (‑234/+57) | borD ← / ← ybcV | prophage lipoprotein BorD/DUF1398 domain‑containing protein YbcV |
| RA | 579,134 | T→C | intergenic (‑241/+50) | borD ← / ← ybcV | prophage lipoprotein BorD/DUF1398 domain‑containing protein YbcV |
| RA | 579,146 | A→G | intergenic (‑253/+38) | borD ← / ← ybcV | prophage lipoprotein BorD/DUF1398 domain‑containing protein YbcV |
| RA | 582,597 | C→T | intergenic (+500/‑278) | tfaD → / → tfaX | putative tail fiber assembly protein TfaD/protein TfaX |
| RA | 623,583 | C→A | V310L (GTG→TTG) | fepB ← | ferric enterobactin ABC transporter periplasmic binding protein |
| RA | 694,941 | G→A | L5L (CTC→CTT) | miaB ← | isopentenyl‑adenosine A37 tRNA methylthiolase |
| RA | 696,470 | C→T | noncoding (35/75 nt) | glnX ← | tRNA‑Gln |
| RA | 776,436 | G→T | S32I (AGT→ATT) | tolA → | Tol‑Pal system protein TolA |
| RA | 780,624 | C→T | noncoding (71/76 nt) | lysT → | tRNA‑Lys |
| RA | 789,580 | C→A | E134* (GAA→TAA) | galK ← | galactokinase |
| RA | 822,527 | C→T | E405K (GAA→AAA) | clsB ← | cardiolipin synthase B |
| RA | 883,396 | C→T | intergenic (‑8/‑277) | ybjG ← / → mdfA | undecaprenyl pyrophosphate phosphatase/multidrug efflux pump MdfA/Na(+):H(+) antiporter/K(+):H(+) antiporter |
| RA | 908,169 | C→T | R38R (AGG→AGA) | ybjT ← | putative NAD(P)‑binding protein YbjT |
| RA | 926,406 | A→G | V13A (GTT→GCT) | infA ← | translation initiation factor IF‑1 |
| RA | 1,005,158 | C→T | H131Y (CAT→TAT) | pyrD → | dihydroorotate dehydrogenase, type 2 |
| JC JC | 1,034,134 | IS30 (–) +2 bp | coding (881‑882/1794 nt) | hyaB → | hydrogenase 1 large subunit |
| RA | 1,076,997 | C→A | R629L (CGC→CTC) | putA ← | fused DNA‑binding transcriptional repressor/proline dehydrogenase/1‑pyrroline‑5‑carboxylate dehydrogenase PutA |
| JC | 1,105,187 | (CAACCCATTGCTTTGACGAAGTTGAG)1→2 | coding (227/333 nt) | csgC → | curlin chaperone |
| RA | 1,123,823 | 2 bp→AG | coding (231‑232/648 nt) | grxB ← | reduced glutaredoxin 2 |
| RA | 1,147,792 | T→A | S58T (TCG→ACG) | plsX → | putative phosphate acyltransferase |
| RA | 1,169,836 | A→G | L180P (CTG→CCG) | ldtC ← | L,D‑transpeptidase LdtC |
| RA | 1,171,607 | A→C | V786V (GTT→GTG) | mfd ← | transcription‑repair coupling factor |
| JC JC | 1,186,598 | IS150 (–) +3 bp | coding (755‑757/1227 nt) | pepT → | peptidase T |
| RA | 1,189,980 | A→G | T156T (ACT→ACC) | phoP ← | DNA‑binding transcriptional dual regulator PhoP |
| RA | 1,194,922 | G→A | T10T (ACC→ACT) | rluE ← | 23S rRNA pseudouridine(2457) synthase |
| RA | 1,201,548 | A→C | T18P (ACC→CCA) | ymfI → | uncharacterized protein YmfI |
| RA | 1,201,550 | C→A | T18P (ACC→CCA) | ymfI → | uncharacterized protein YmfI |
| JC JC | 1,248,053 | IS30 (+) +2 bp | coding (1061‑1062/1419 nt) | dhaM ← | dihydroxyacetone kinase subunit M |
| RA | 1,253,002 | C→T | intergenic (+17/+83) | dhaR → / ← ycgV | DNA‑binding transcriptional dual regulator DhaR/putative autotransporter adhesin YcgV |
| RA | 1,301,992 | A→T | N271Y (AAT→TAT) | oppA → | oligopeptide ABC transporter periplasmic binding protein |
| RA | 1,306,736 | T→G | S325A (TCC→GCC) | oppF → | murein tripeptide ABC transporter/oligopeptide ABC transporter ATP binding subunit OppF |
| JC JC | 1,326,115 | IS5 (+) +4 bp | coding (1370‑1373/1896 nt) | yciQ → | DUF2207 domain‑containing protein YciQ |
| RA | 1,331,059 | 2 bp→AT | coding (12‑13/2598 nt) | topA → | DNA topoisomerase 1 |
| RA | 1,337,394 | A→G | S522G (AGC→GGC) | acnA → | aconitate hydratase 1 |
| RA | 1,358,859 | T→C | Y110C (TAT→TGT) | puuP ← | putrescine:H(+) symporter PuuP |
| MC JC | 1,382,711 | Δ13,333 bp | IS5‑mediated | [ompG]–ynaI | [ompG], ycjW, ycjX, ycjF, tyrR, tpx, ycjG, mpaA, ymjC, ymjD, ycjY, pgrR, mppA, ynaI |
| RA | 1,405,758 | G→A | intergenic (‑7/‑221) | mcaS ← / → smrA | small regulatory RNA McaS/DNA endonuclease SmrA |
| JC JC | 1,495,000 | IS2 (+) +5 bp | coding (68‑72/924 nt) | ydcI ← | DNA‑binding transcriptional dual regulator YdcI |
| RA | 1,497,385 | 4 bp→CAA | coding (530‑533/1656 nt) | opgD → | glucans biosynthesis protein D |
| RA | 1,629,247 | C→T | I11I (ATC→ATT) | ydfZ → | putative selenoprotein YdfZ |
| RA | 1,643,679 | A→T | L209Q (CTG→CAG) | ydfU ← | protein YdfU |
| RA | 1,652,331 | T→C | intergenic (+2346/+397) | ydfD → / ← ynfP | lysis protein/protein YnfP |
| JC JC | 1,655,935 | IS2 (–) +5 bp | coding (128‑132/342 nt) | ynfB → | DUF1283 domain‑containing protein YnfB |
| RA | 1,667,460 | G→A | Q369* (CAG→TAG) | mlc ← | DNA‑binding transcriptional repressor Mlc |
| RA | 1,748,841 | C→T | R240K (AGA→AAA) | ydhT ← | uncharacterized protein YdhT |
| RA | 1,823,378 | T→C | intergenic (+93/‑137) | nadE → / → cho | NH3‑dependent NAD(+) synthetase/excinuclease Cho |
| RA | 1,848,300 | 2 bp→TT | coding (376‑377/552 nt) | ydjA ← | putative oxidoreductase YdjA |
| JC JC | 1,862,422 | IS5 (+) +4 bp | coding (5‑8/414 nt) | msrB ← | methionine sulfoxide reductase B |
| RA | 1,894,839 | T→C | L12P (CTC→CCC) | pabB → | aminodeoxychorismate synthase subunit 1 |
| RA | 1,900,505 | C→T | V361I (GTT→ATT) | yoaE ← | TerC family inner membrane protein YoaE |
| JC JC | 1,907,371 | IS1 (+) +9 bp | coding (57‑65/210 nt) | cspC ← | transcription antiterminator and regulator of mRNA stability CspC |
| JC JC | 1,910,137 | IS30 (+) +2 bp | intergenic (‑38/‑138) | kdgR ← / → yebQ | DNA‑binding transcriptional repressor KdgR/putative transporter YebQ |
| RA | 1,925,013 | C→A | intergenic (‑44/‑95) | yobA ← / → holE | copper‑binding protein/DNA polymerase III subunit theta |
| RA | 1,972,200 | +C | coding (492/1662 nt) | tar ← | methyl‑accepting chemotaxis protein Tar |
| RA | 1,977,357 | G→A | P163L (CCA→CTA) | flhC ← | DNA‑binding transcriptional dual regulator FlhC |
| JC JC | 1,979,486 | IS5 (+) +4 bp | intergenic (‑271/‑264) | insA5 ← / → uspC | IS1 family protein InsA/universal stress protein C |
| RA | 2,040,433 | C→A | A319D (GCC→GAC) | msrP → | protein‑L‑methionine sulfoxide reductase catalytic subunit MsrP |
| RA | 2,041,278 | G→A | intergenic (+160/‑97) | msrQ → / → zinT | membrane‑bound flavocytochrome MsrQ/metal‑binding protein ZinT |
| RA | 2,052,885 | G→A | intergenic (+871/‑758) | yeeJ → / → shiA | inverse autotransporter adhesin/shikimate:H(+) symporter |
| RA | 2,104,024 | G→T | I162I (ATC→ATA) | wbbK ← | putative glycosyltransferase WbbK |
| RA | 2,111,259 | Δ1 bp | coding (718/900 nt) | rfbD ← | dTDP‑4‑dehydrorhamnose reductase |
| JC JC | 2,129,640 | IS5 (–) +4 bp | coding (8‑11/747 nt) | wcaE ← | GDP‑Fuc:2/3‑O‑Ac‑alpha‑L‑Fuc‑(1‑>3)‑alpha‑D‑Glc‑ PP‑Und alpha‑(1,4)‑fucosyltransferase |
| RA | 2,142,598 | G→A | L117L (CTC→CTT) | udk ← | uridine/cytidine kinase |
| RA | 2,173,363 | Δ2 bp | intergenic (‑490/+918) | gatD ← / ← gatB | galactitol‑1‑phosphate 5‑dehydrogenase/galactitol‑specific PTS enzyme IIB component |
| RA | 2,173,448 | C→T | intergenic (‑575/+834) | gatD ← / ← gatB | galactitol‑1‑phosphate 5‑dehydrogenase/galactitol‑specific PTS enzyme IIB component |
| JC JC | 2,174,782 | IS1 (+) +9 bp | coding (260‑268/453 nt) | gatA ← | galactitol‑specific PTS enzyme IIA component |
| RA | 2,233,609 | C→T | Q4* (CAG→TAG) | yeiS → | DUF2542 domain‑containing protein YeiS |
| JC JC | 2,240,077 | IS2 (+) +5 bp | coding (268‑272/999 nt) | mglB ← | D‑galactose/methyl‑galactoside ABC transporter periplasmic binding protein |
| RA | 2,242,247 | C→T | G241R (GGG→AGG) | yeiB ← | DUF418 domain‑containing protein YeiB |
| RA | 2,247,134 | A→C | Y467D (TAC→GAC) | lysP ← | lysine:H(+) symporter |
| RA | 2,268,174 | C→T | L116L (CTG→TTG) | yeiR → | zinc‑binding GTPase YeiR |
| RA | 2,404,402 | G→A | S71L (TCG→TTG) | nuoB ← | NADH:quinone oxidoreductase subunit B |
| MC JC | 2,558,699 | Δ6,790 bp | intZ–[eutA] | intZ, yffL, yffM, yffN, yffO, yffP, yffQ, yffR, yffS, [eutA] | |
| RA | 2,587,112 | C→T | A461V (GCA→GTA) | narQ → | sensor histidine kinase NarQ |
| JC JC | 2,698,402 | IS30 (+) +2 bp | coding (148‑149/636 nt) | pgpC ← | phosphatidylglycerophosphatase C |
| RA | 2,774,947 | G→A | G544S (GGT→AGT) | yfjW → | uncharacterized protein YfjW |
| RA | 2,867,455 | G→A | Q33* (CAG→TAG) | rpoS ← | RNA polymerase sigma factor RpoS |
| RA | 2,880,635 | T→C | L138L (TTA→TTG) | casD ← | type I‑E CRISPR system Cascade subunit CasD |
| RA | 2,926,772 | C→A | G155G (GGC→GGA) | ppnN → | nucleotide 5'‑monophosphate nucleosidase |
| RA | 3,025,601 | (T)5→4 | coding (1251/1401 nt) | xanQ → | xanthine:H(+) symporter XanQ |
| RA | 3,070,858 | T→G | K129N (AAA→AAC) | fbaA ← | fructose‑bisphosphate aldolase class II |
| JC | 3,176,353 | (GCA)4→3 | coding (479‑481/828 nt) | cpdA ← | cAMP phosphodiesterase |
| RA | 3,207,549 | Δ1 bp | coding (179/606 nt) | ttdB → | L(+)‑tartrate dehydratase subunit beta |
| JC JC | 3,259,884 | IS30 (–) +2 bp | coding (226‑227/390 nt) | tdcF ← | putative enamine/imine deaminase |
| RA | 3,279,276 | C→G | F121L (TTC→TTG) | kbaZ → | putative tagatose‑1,6‑bisphosphate aldolase 1 chaperone |
| RA | 3,296,481 | G→A | V25M (GTG→ATG) | dolP → | division and outer membrane stress‑associated lipid‑binding lipoprotein |
| RA | 3,329,743 | G→T | D261Y (GAT→TAT) | dacB → | peptidoglycan DD‑endopeptidase DacB |
| MC JC | 3,350,999 | Δ9 bp | coding (2019‑2027/2337 nt) | arcB ← | sensor histidine kinase ArcB |
| RA | 3,388,041 | T→G | T50P (ACG→CCG) | aaeB ← | aromatic carboxylic acid efflux pump subunit AaeB |
| RA | 3,411,689 | G→T | E13* (GAA→TAA) | yhdJ → | DNA adenine methyltransferase |
| RA | 3,433,900 | C→T | L71L (CTA→TTA) | def → | peptide deformylase |
| RA | 3,474,291 | T→G | K88Q (AAA→CAA) | rpsL ← | 30S ribosomal subunit protein S12 |
| RA | 3,474,425 | T→G | K43T (AAA→ACA) | rpsL ← | 30S ribosomal subunit protein S12 |
| JC JC | 3,485,920 | IS2 (–) +5 bp | intergenic (‑102/‑196) | yhfA ← / → crp | OsmC family protein YhfA/DNA‑binding transcriptional dual regulator CRP |
| RA | 3,486,502 | C→T | T128I (ACT→ATT) | crp → | DNA‑binding transcriptional dual regulator CRP |
| RA | 3,511,466 | C→T | V293V (GTG→GTA) | yhfZ ← | putative DNA‑binding transcriptional regulator YhfZ |
| RA | 3,555,047 | G→T | V655F (GTC→TTC) | malT → | DNA‑binding transcriptional activator MalT |
| RA | 3,560,455 | +G | intergenic (+589/+167) | rtcR → / ← glpG | DNA‑binding transcriptional activator RtcR/rhomboid protease GlpG |
| RA | 3,647,428 | C→T | A377V (GCG→GTG) | gor → | glutathione reductase (NADPH) |
| RA | 3,707,947 | C→A | intergenic (‑242/+669) | dppA ← / ← proK | dipeptide ABC transporter periplasmic binding protein/tRNA‑Pro |
| RA | 3,719,429 | G→A | intergenic (‑385/‑49) | yiaF ← / → yiaG | DUF3053 domain‑containing protein YiaF/putative DNA‑binding transcriptional regulator YiaG |
| RA | 3,725,176 | T→G | E48A (GAG→GCG) | glyQ ← | glycine‑‑tRNA ligase subunit alpha |
| JC JC | 3,727,247 | IS5 (+) +4 bp | coding (112‑115/438 nt) | yiaA ← | PF05360 family inner membrane protein YiaA |
| RA | 3,729,440 | 2 bp→TT | noncoding (105‑106/160 nt) | xylZ ← | small RNA XylZ |
| RA | 3,730,560 | C→T | W69* (TGG→TAG) | xylA ← | xylose isomerase |
| RA | 3,770,539 | C→T | V281M (GTG→ATG) | yibH ← | inner membrane protein YibH |
| RA | 3,773,173 | Δ1 bp | coding (893/1914 nt) | mtlA → | mannitol‑specific PTS enzyme IICBA component |
| RA | 3,773,176 | C→T | S299F (TCT→TTT) | mtlA → | mannitol‑specific PTS enzyme IICBA component |
| JC JC | 3,798,958 | IS1 (–) +8 bp | coding (348‑355/1074 nt) | waaU ← | putative ADP‑heptose:LPS heptosyltransferase 4 |
| RA | 3,814,074 | C→A | T49K (ACG→AAG) | dut → | dUTP diphosphatase |
| RA | 3,815,883 | +C | coding (667/687 nt) | rph ← | truncated RNase PH |
| RA | 3,828,778 | C→A | intergenic (‑113/‑167) | gltS ← / → xanP | glutamate:sodium symporter/xanthine:H(+) symporter XanP |
| JC JC | 3,889,583 | IS30 (–) +2 bp | coding (854‑855/1416 nt) | tnaA → | tryptophanase |
| RA | 3,926,991 | G→A | L5L (CTG→TTG) | asnC ← | DNA‑binding transcriptional dual regulator AsnC |
| RA | 3,966,530 | 2 bp→TT | coding (114‑115/1260 nt) | rho → | transcription termination factor Rho |
| JC JC | 3,991,038 | IS30 (+) +2 bp | intergenic (‑272/‑114) | hemC ← / → cyaA | hydroxymethylbilane synthase/adenylate cyclase |
| RA | 4,223,638 | T→C | intergenic (‑10/‑190) | iclR ← / → metH | DNA‑binding transcriptional repressor IclR/cobalamin‑dependent methionine synthase |
| RA | 4,296,381 | +GC | intergenic (+587/+55) | gltP → / ← yjcO | glutamate/aspartate : H(+) symporter GltP/Sel1 repeat‑containing protein YjcO |
| RA | 4,325,644 | C→T | S33N (AGC→AAC) | yjdN ← | PF06983 family protein YjdN |
| RA | 4,331,890 | C→T | L463L (CTC→CTT) | proP → | osmolyte:H(+) symporter ProP |
| RA | 4,392,997 | G→A | V357V (GTC→GTT) | queG ← | epoxyqueuosine reductase |
| RA | 4,393,552 | G→A | F172F (TTC→TTT) | queG ← | epoxyqueuosine reductase |
| RA | 4,396,373 | C→T | T103T (ACC→ACT) | amiB → | N‑acetylmuramoyl‑L‑alanine amidase B |
| RA | 4,396,772 | T→C | F236F (TTT→TTC) | amiB → | N‑acetylmuramoyl‑L‑alanine amidase B |
| RA | 4,415,473 | 2 bp→AT | coding (1199‑1200/1626 nt) | aidB → | putative acyl‑CoA dehydrogenase AidB |
| RA | 4,425,688 | C→A | H57N (CAC→AAC) | priB → | primosomal replication protein N |
| RA | 4,425,696 | C→A | N59K (AAC→AAA) | priB → | primosomal replication protein N |
| RA | 4,430,293 | G→T | V144L (GTG→TTG) | cycA → | D‑serine/alanine/glycine/:H(+)symporter |
| RA | 4,436,956 | 2 bp→TT | coding (202‑203/741 nt) | cysQ → | 3'(2'),5'‑bisphosphate nucleotidase |
| RA | 4,510,238 | T→G | intergenic (+445/+452) | insO → / ← fecE | IS911B regulator fragment/ferric citrate ABC transporter ATP binding subunit |
| RA | 4,532,409 | T→G | intergenic (‑758/+28) | sgcX ← / ← yjhP | putative endoglucanase with Zn‑dependent exopeptidase domain/putative methyltransferase YjhP |
| RA | 4,546,601 | C→T | I502I (ATC→ATT) | fimD → | type I fimbriae usher protein |
| RA | 4,549,037 | T→C | V77A (GTC→GCC) | fimH → | type 1 fimbriae D‑mannose specific adhesin |
| RA | 4,578,548 | G→A | Q264* (CAG→TAG) Q264* (CAG→TAG) |
mcrB ← mcrB ← |
5‑methylcytosine‑specific restriction enzyme subunit McrB 5‑methylcytosine‑specific restriction enzyme subunit McrB |
| JC JC | 4,640,418 | IS30 (–) +2 bp | coding (17‑18/141 nt) | yjjY → | uncharacterized protein YjjY |
| Unassigned missing coverage evidence | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| seq id | start | end | size | ←reads | reads→ | gene | description | |||
| * | * | ÷ | NC_000913 | 574776–575790 | 578267–578201 | 2412–3492 | 37 [36] | [35] 39 | [insH2]–[rzpD] | [insH2],nmpC,essD,rrrD,[rzpD] |
| * | * | ÷ | NC_000913 | 1299499–1300699 | 1300758 | 60–1260 | 113 [0] | [0] 117 | insH21 | insH21 |
| * | * | ÷ | NC_000913 | 3423756–3424233 | 3424492–3424239 | 7–737 | 38 [36] | [35] 37 | [rrfD]–[rrlD] | [rrfD],[rrlD] |
| * | * | ÷ | NC_000913 | 4542159 | 4542681 | 523 | 106 [0] | [4] 141 | [fimE] | [fimE] |
| Unassigned new junction evidence | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
| * | ? | NC_000913 | 257905 = | NA (NA) | 118 (1.120) +AAG |
70/592 | 0.2 | 85.0% | intergenic (+6/+18) | crl/insB9 | RNA polymerase holoenzyme assembly factor Crl/IS1 family transposase B |
| ? | NC_000913 | = 4542999 | 21 (0.200) | intergenic (+366/‑116) | fimE/fimA | regulator for fimA/type 1 fimbriae major subunit | |||||
| * | ? | NC_000913 | 270541 = | NA (NA) | 45 (0.420) | 34/598 | 2.1 | 37.2% | noncoding (1/1221 nt) | IS30 | repeat region |
| ? | NC_000913 | = 755660 | 76 (0.710) | coding (101/348 nt) | sdhD | succinate:quinone oxidoreductase, membrane protein SdhD | |||||
| * | ? | NC_000913 | 270541 = | NA (NA) | 49 (0.460) | 34/598 | 2.1 | 34.5% | noncoding (1/1221 nt) | IS30 | repeat region |
| ? | NC_000913 | = 971729 | 93 (0.870) | intergenic (+131/‑23) | kdsB/ycbJ | 3‑deoxy‑manno‑octulosonate cytidylyltransferase/putative phosphotransferase YcbJ | |||||
| * | ? | NC_000913 | = 271761 | NA (NA) | 55 (0.530) | 44/586 | 1.2 | 44.2% | noncoding (1221/1221 nt) | IS30 | repeat region |
| ? | NC_000913 | = 1618915 | 70 (0.660) | intergenic (‑7/‑205) | marC/marR | inner membrane protein MarC/DNA‑binding transcriptional repressor MarR | |||||
| * | ? | NC_000913 | = 275149 | NA (NA) | 134 (1.260) | 84/598 | 0.1 | 43.6% | noncoding (1/1195 nt) | IS5 | repeat region |
| ? | NC_000913 | 579184 = | 173 (1.620) | coding (411/411 nt) | ybcV | DUF1398 domain‑containing protein YbcV | |||||
| * | ? | NC_000913 | 755659 = | 77 (0.720) | 52 (0.490) | 43/598 | 1.3 | 40.3% | coding (100/348 nt) | sdhD | succinate:quinone oxidoreductase, membrane protein SdhD |
| ? | NC_000913 | = 1470516 | NA (NA) | noncoding (1221/1221 nt) | IS30 | repeat region | |||||
| * | ? | NC_000913 | 971728 = | 94 (0.890) | 55 (0.520) | 42/594 | 1.4 | 36.9% | intergenic (+130/‑24) | kdsB/ycbJ | 3‑deoxy‑manno‑octulosonate cytidylyltransferase/putative phosphotransferase YcbJ |
| ? | NC_000913 | = 1470516 | NA (NA) | noncoding (1221/1221 nt) | IS30 | repeat region | |||||
| * | ? | NC_000913 | 1207790 = | 36 (0.340) | 63 (0.620) | 43/566 | 1.1 | 61.4% | coding (290/630 nt) | ycfK | protein StfP |
| ? | NC_000913 | 1209619 = | 45 (0.450) | intergenic (‑500/‑66) | tfaE/pinE | putative tail fiber assembly protein TfaE/site‑specific DNA recombinase | |||||
| * | ? | NC_000913 | = 1207805 | 43 (0.400) | 65 (0.640) | 49/566 | 0.8 | 60.3% | coding (305/630 nt) | ycfK | protein StfP |
| ? | NC_000913 | = 1209602 | 45 (0.450) | intergenic (‑483/‑83) | tfaE/pinE | putative tail fiber assembly protein TfaE/site‑specific DNA recombinase | |||||
| * | ? | NC_000913 | = 1299498 | 0 (0.000) | 92 (1.130) +70 bp |
58/458 | 0.1 | 100% | intergenic (+253/‑69) | ychE/insH21 | MarC family putative inner membrane protein YchE/IS5 family transposase and trans‑activator |
| ? | NC_000913 | = 1979270 | NA (NA) | noncoding (1/768 nt) | IS1 | repeat region | |||||
| * | ? | NC_000913 | 1300759 = | 0 (0.000) | 115 (1.080) | 79/598 | 0.1 | 100% | intergenic (+212/‑423) | insH21/oppA | IS5 family transposase and trans‑activator/oligopeptide ABC transporter periplasmic binding protein |
| ? | NC_000913 | 1978503 = | NA (NA) | noncoding (768/768 nt) | IS1 | repeat region | |||||
| * | ? | NC_000913 | = 1397238 | NA (NA) | 74 (0.700) | 60/596 | 0.5 | 52.5% | noncoding (1195/1195 nt) | IS5 | repeat region |
| ? | NC_000913 | 1588614 = | 67 (0.630) | coding (226/531 nt) | ydeS | putative fimbrial protein YdeS | |||||
| * | ? | NC_000913 | 1469296 = | NA (NA) | 49 (0.460) | 37/598 | 1.8 | 40.8% | noncoding (1/1221 nt) | IS30 | repeat region |
| ? | NC_000913 | 1618914 = | 71 (0.670) | intergenic (‑6/‑206) | marC/marR | inner membrane protein MarC/DNA‑binding transcriptional repressor MarR | |||||
| * | ? | NC_000913 | 1469296 = | NA (NA) | 60 (0.560) | 52/598 | 0.8 | 53.1% | noncoding (1/1221 nt) | IS30 | repeat region |
| ? | NC_000913 | = 1690870 | 53 (0.500) | coding (1019/1509 nt) | ydgA | DUF945 domain‑containing protein YdgA | |||||
| * | ? | NC_000913 | 1469296 = | NA (NA) | 41 (0.390) | 30/594 | 2.5 | 29.3% | noncoding (1/1221 nt) | IS30 | repeat region |
| ? | NC_000913 | = 1995730 | 99 (0.930) | coding (76/177 nt) | yecU | protein YecU | |||||
| * | ? | NC_000913 | 1469296 = | NA (NA) | 40 (0.380) | 32/596 | 2.3 | 41.7% | noncoding (1/1221 nt) | IS30 | repeat region |
| ? | NC_000913 | = 2978043 | 56 (0.530) | coding (857/1263 nt) | lysA | diaminopimelate decarboxylase | |||||
| * | ? | NC_000913 | 1469296 = | NA (NA) | 42 (0.390) | 32/598 | 2.3 | 34.7% | noncoding (1/1221 nt) | IS30 | repeat region |
| ? | NC_000913 | = 3735650 | 79 (0.740) | coding (672/1179 nt) | xylR | DNA‑binding transcriptional dual regulator XylR | |||||
| * | ? | NC_000913 | = 1470516 | NA (NA) | 55 (0.520) | 43/598 | 1.3 | 50.9% | noncoding (1221/1221 nt) | IS30 | repeat region |
| ? | NC_000913 | 1690869 = | 53 (0.500) | coding (1018/1509 nt) | ydgA | DUF945 domain‑containing protein YdgA | |||||
| * | ? | NC_000913 | = 1470516 | NA (NA) | 33 (0.310) | 27/598 | 3.0 | 24.8% | noncoding (1221/1221 nt) | IS30 | repeat region |
| ? | NC_000913 | 1855666 = | 100 (0.940) | coding (306/981 nt) | ydjG | NADH‑dependent methylglyoxal reductase | |||||
| * | ? | NC_000913 | = 1470516 | NA (NA) | 33 (0.310) | 27/598 | 3.0 | 24.4% | noncoding (1221/1221 nt) | IS30 | repeat region |
| ? | NC_000913 | 1995729 = | 102 (0.960) | coding (75/177 nt) | yecU | protein YecU | |||||
| * | ? | NC_000913 | = 1470516 | NA (NA) | 42 (0.390) | 36/598 | 1.9 | 43.3% | noncoding (1221/1221 nt) | IS30 | repeat region |
| ? | NC_000913 | 2978042 = | 55 (0.520) | coding (858/1263 nt) | lysA | diaminopimelate decarboxylase | |||||
| * | ? | NC_000913 | = 1588617 | 68 (0.640) | 79 (0.740) | 52/598 | 0.8 | 53.7% | coding (223/531 nt) | ydeS | putative fimbrial protein YdeS |
| ? | NC_000913 | = 2290113 | NA (NA) | noncoding (1/1195 nt) | IS5 | repeat region | |||||
| * | ? | NC_000913 | 1743496 = | 64 (0.600) | 36 (0.340) | 28/598 | 2.8 | 36.0% | coding (40/1374 nt) | mdtK | multidrug efflux pump MdtK |
| ? | NC_000913 | = 2290113 | NA (NA) | noncoding (1/1195 nt) | IS5 | repeat region | |||||
| * | ? | NC_000913 | = 1743499 | 65 (0.610) | 67 (0.630) | 54/598 | 0.7 | 50.8% | coding (43/1374 nt) | mdtK | multidrug efflux pump MdtK |
| ? | NC_000913 | 2101749 = | NA (NA) | noncoding (1195/1195 nt) | IS5 | repeat region | |||||
| * | ? | NC_000913 | = 1978502 | 1 (0.010) | 117 (1.130) | 71/582 | 0.2 | 99.6% | intergenic (‑305/+16) | flhD/insB5 | DNA‑binding transcriptional dual regulator FlhD/IS1 family protein InsB |
| ? | NC_000913 | 1979279 = | 0 (0.000) | intergenic (‑64/‑474) | insA5/uspC | IS1 family protein InsA/universal stress protein C | |||||
| * | ? | NC_000913 | 2288919 = | NA (NA) | 78 (0.730) | 48/596 | 1.0 | 58.7% | noncoding (1195/1195 nt) | IS5 | repeat region |
| ? | NC_000913 | = 2992205 | 55 (0.520) | coding (112/1377 nt) | ygeH | putative transcriptional regulator YgeH | |||||
| * | ? | NC_000913 | = 2290113 | NA (NA) | 73 (0.680) | 51/598 | 0.8 | 57.5% | noncoding (1/1195 nt) | IS5 | repeat region |
| ? | NC_000913 | 2992202 = | 54 (0.510) | coding (109/1377 nt) | ygeH | putative transcriptional regulator YgeH | |||||
| * | ? | NC_000913 | 3583428 = | NA (NA) | 106 (0.990) | 68/598 | 0.3 | 100% | noncoding (1/768 nt) | IS1 | repeat region |
| ? | NC_000913 | = 4542158 | 0 (0.000) | coding (122/597 nt) | fimE | regulator for fimA | |||||
| * | ? | NC_000913 | 3735649 = | 80 (0.750) | 41 (0.390) | 31/596 | 2.4 | 33.9% | coding (671/1179 nt) | xylR | DNA‑binding transcriptional dual regulator XylR |
| ? | NC_000913 | 4507459 = | NA (NA) | noncoding (1221/1221 nt) | IS30 | repeat region | |||||
| * | ? | NC_000913 | 4542682 = | 4 (0.040) | 137 (1.320) | 81/580 | 0.1 | 92.6% | intergenic (+49/‑433) | fimE/fimA | regulator for fimA/type 1 fimbriae major subunit |
| ? | NC_000913 | 4542996 = | 18 (0.170) | intergenic (+363/‑119) | fimE/fimA | regulator for fimA/type 1 fimbriae major subunit | |||||