The creERT2 gene under regulation by hsp70l promoter was inserted upstream to gbx2 in a homology-independent knock-in technique using the CRISPR/Cas9 system. Thus, creERT2 is specifically expressed in embryos, precisely recapitulating endogenous expression of gbx2. By tamoxifen treatment, it is possilbe to induce floxed genes at desired times in gbx2 domains of embryos. This transgene can be identified by PCR-based genotyping that amplifies the boundary region between the CreERT2 gene and gbx2 upsteram DNA (primers; GTGACGTTCTAATTTAAGAGACAGCA & AGGGTTATTGTCTCATGAGCGG).
In addition, the ZsGreen gene tagged at its 5'-end with a floxed stop sequence and placed downstream of the CAG promoter was incorporated into the zebrafish genome using the Tol2 system. This gene can be ideintifed by PCR that amplifies the connecting sequence between the CAG promoter and Tol2 R arm (primers; CTAATGACCCCGTAATTGAT & TGAAAGTACAAGTACTTAGG).
|
