Strain Name: rbp1a |
|
| Allele | |
| Strain Name | rbp1a |
| Type | Mutant |
| Genotype | |
| Affected Gene | retinol binding protein 1a (rbp1a) |
| Origin and Depositor | National Rehabilitation Center for Persons with Disabilities (Yuko Seko) |
| Link to ZFIN |
| Information | |
|
The sequence in exon 2 within the lipocalin domain (position 157-179, CAGCTACCTCATCCTAGATAAGG, of NM_001114899.1) was chosen for the target of CRISPR/Cas9-meidiated rbp1a gene knockout. An individual that had a deletion of 6 nucleotides (CCTAGA, nucleotide position 169-174 of NM_001114899.1) and an insertion of a nucleotide (G) in the deleted region (Figure S1C), which leads frameshift after the first 38 amino acids of NP_001108371.1 resulting in the premature stop codon, was chosen for the establishment of the rbp1a knockout line. |
| The Conditions to Distribute Strains | |
|
In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested. In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. Takita S, Seko Y eys+/-; lrp5+/- zebrafish reveals Lrp5 can be the receptor of retinol in the visual cycle. iScience Nov 3;23(12):101762. doi: 10.1016/j.isci.2020.101762. eCollection 2020 Dec 18. The BIOLOGICAL RESOURCE shall be used only for basic research purpose (NOT for commercial purpose). In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, RECIPIENT must forward a pre-print copy of the publication to the DEPOSITOR's scientist. If RECIPIENT scientist's use of the BIOLOGICAL RESOURCE results in an invention or substance (“New Intellectual Property”), RECIPIENT will also promptly disclose the invention or substance to RECIPIENT and notify DEPOSITOR of the role of the BIOLOGICAL RESOURCE, DEPOSITOR scientist and any other person affiliated with DEPOSITOR in the creation of the New Intellectual Property. |
| Request |
|
| Reference | |
|
|
| Facility | RIKEN Center for Brain Science |