Strain Name: tbx1 / Allele: kt1110 |
|
| Allele | kt1110 |
| Strain Name | tbx1 |
| Type | Mutant |
| Genotype | |
| Affected Gene | tbx1 |
| Origin and Depositor | National Institute for Basic Biology (Shinji Takada) |
| Link to ZFIN |
| Information | |
|
11base deletion was introduced in exon1 of tbx1 gene by using CRISPR method. The heterozygous fish was identified by T7-endonuclease assay using followed primers: pax1a-T7F: CAGCGCAAATTGTAAATCCA Mutation: WT: AGCAGCCTCAATACGCCCGGGAGTTACC |
| The Conditions to Distribute Strains | |
| In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested. |
| Request |
|
| Reference | |
| Facility | RIKEN Center for Brain Science |
