Strain Name: six7; six6a; six6b; Tg(zfSWS2-3.5A:EGFP) / Allele: ja51; ja62; ja63; kj11

Allele ja51; ja62; ja63; kj11
Strain Name six7; six6a; six6b; Tg(zfSWS2-3.5A:EGFP)
Type Mutant, Transgenic
Genotype
Affected Gene
Origin and Depositor The University of Tokyo (Yoshitaka Fukada); The University of Tokyo (Shoji Kawamura)
Link to ZFIN
Information
(ja51;ja62;ja63) Genotypes were determined by a combination of PCR and subsequent digestion by endonuclease PvuII (six6a) or XhoI (six6b and six7). First, the region flanking the TALEN cleavage site was amplified by PCR using the following primers, six6aTALEN_Fw (5’- GGGTTGCTTCCAGATTTCC -3’) and six6aTALEN_Rv (5’- GTTTTGCGTGTGAGTCTTTG -3’); six6bTALEN_Fw (5’- CGACATCTCCATTTCTCTG -3’) and six6bTALEN_Rv (5’- CAGTGCGTCTTTTGTTCTC -3’); six7TALEN_Fw (5’- TCTGCTGCTCCTCCTTTAC -3’) and six7TALEN_Rv (5’- CTTACGGATGCGGTACTTC -3’). Second, the PCR product was digested with the restriction enzyme, and TALEN-induced mutations were checked by loss of the digestion site.
(kj11) Zebrafish have one type of rod and four types of cone photoreceptor cells in the retina. The four cone types express phylogenetically and spectrally distinct types of visual opsins. Using zebrafish as a model animal, we are exploring the molecular mechanism of the cell-type specific expression of the opsin genes. We make DNA constructs where test genomic regions in or around the opsin genes are conjugated to the GFP (Green Fluorescent Protein)-related reporter genes and introduce them to zebrafish embryos to establish transgenic lines. The Tg(zfSWS2-3.5A:EGFP)kj11 is one of such transgenic zebrafish lines, where the 3.5-kb region immediately upstream of the SWS2 opsin (blue type opsin) gene is introduced with the EGFP reporter. It expresses GFP specifically in the long single cones (LSCs) of the retina. In effect, LSCs of the zebrafish are visualized by GFP. The fish would be useful for the studies of retinal development and screening of retinal mutants.  
The Conditions to Distribute Strains
(ja51;ja62;ja63)
In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested.
In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested.
Ogawa Y, et al. (2019) Six6 and Six7 coordinately regulate expression of middle-wavelength opsins in zebrafish. Proc Natl Acad Sci U S A:201812884.
The BIOLOGICAL RESOURCE shall be used only for basic research purpose (NOT for commercial purpose).

(kj11)
In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested.
In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested.
Takechi M., Seno, S. and Kawamura, S.(2008). Identification of cis-acting elements repressing blue opsin expression in zebrafish UV cones and pineal cells. The Journal of Biological Chemistry, 283 (46): 31625-31632.  
Request To Order
Reference

Ogawa Y, Shiraki T, Asano Y, Muto A, Kawakami K, Suzuki Y, Kojima D, Fukada Y. Six6 and Six7 coordinately regulate expression of middle-wavelength opsins in zebrafish. Proc. Natl. Acad. Sci. U.S.A. 2019 ; 116(10) : 4651-4660 .

Takechi M, Seno S, Kawamura S. Identification of cis-acting elements repressing blue opsin expression in zebrafish UV cones and pineal cells. J. Biol. Chem. 2008 ; 283(46) : 31625-31632 .

 
Facility RIKEN Center for Brain Science