Strain Name: ahsg1 / Allele: +/-(-4bp) |
|
| Allele | +/-(-4bp) |
| Strain Name | ahsg1 |
| Type | Mutant |
| Genotype | |
| Affected Gene | alpha-2-HS-glycoprotein 1 |
| Origin and Depositor | Advanced Telecommunications Research Institute International [ATR] (Thomas N. Sato) |
| Link to ZFIN |
| Information | |
| A deletion mutation (4 bp deletion) was introduced in ahsg1 gene by a CRISPR/CAS9 method. The mutation can be detected by HRM analysis with the primers: Fw: TTGTTGAGGATTCTTATGCAGC, Rv:CTGCTAATACGGCATTGTTGTC. The sequence of mutation can be read by direct sequence with the primers: Fw:TAAACAAACTGCCATGACATCC, Rv:AGGCGACTCACTTTCTTCTCTG, Sequencing analysis:GCTGTCCTGGGACACAAAC. |
| The Conditions to Distribute Strains | |
|
In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested. In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. Re-evaluating functional landscape of the cardiovascular system during development. Norio Takada, Madoka Omae, Fumihiko Sagawa, Neil C. Chi, Satsuki Endo, Satoshi Kozawa, Thomas N. Sato. Biology Open (2017) 15:1756-1770 The recipient shall disclose all of the research results to be obtained by use of the BIOLOGICAL RESOURCE to the DEPOSITOR. Prior to publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, the recipient shall acquire the consent from the DEPOSITOR. The BIOLOGICAL RESOURCE shall be used only for basic research purpose (NOT for commercial purpose). The recipient and the DEPOSITOR shall sign an MTA, which set forth the terms and conditions to use the intellectual property rights based on the results of research using the BIOLOGICAL RESOURCE and so on. The recipient shall be sent an agreement for distribution obtained from the DEPOSITOR to NZC. |
| Request |
|
| Reference | |
|
|
| Facility | RIKEN Center for Brain Science |
