Strain Name: clptm1 / Allele: agu4 |
|
| Allele | agu4 |
| Strain Name | clptm1 |
| Type | Mutant |
| Genotype | |
| Affected Gene | |
| Origin and Depositor | Hiromi Hirata (Aoyama Gakuin University) |
| Link to ZFIN |
| Information | |
| This allele harbors 20 base deletion (CGTCTCACATACTGCCCCCT) in a coding sequence of clptm1 and was generated by CRISPER/Cas9 technology. |
| The Conditions to Distribute Strains | |
| In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, co-authorship of the DEPOSITOR is required. |
| Request |
|
| Reference | |
| Facility | RIKEN Center for Brain Science |