| Predicted mutation | ||||||
|---|---|---|---|---|---|---|
| evidence | seq id | position | mutation | annotation | gene | description |
| JC JC | NC_000913 | 1,271,657 | IS5 (+) +4 bp | coding (190‑193/1101 nt) | chaA ← | Na(+)/K(+):H(+) antiporter ChaA |
| New junction evidence | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
| * | ? | NC_000913 | = 275149 | NA (NA) | 35 (0.970) | 32/486 | 0.2 | 100% | noncoding (1/1195 nt) | IS5 | repeat region |
| ? | NC_000913 | = 1271660 | 0 (0.000) | coding (190/1101 nt) | chaA | Na(+)/K(+):H(+) antiporter ChaA | |||||
| * | ? | NC_000913 | 1271657 = | 0 (0.000) | 18 (0.500) | 18/486 | 0.8 | 100% | coding (193/1101 nt) | chaA | Na(+)/K(+):H(+) antiporter ChaA |
| ? | NC_000913 | 2101749 = | NA (NA) | noncoding (1195/1195 nt) | IS5 | repeat region | |||||
GAAAATCTCTTTTCTGGTCTGACGGCGCTTACTGCTGAATTCACTGTCGGCGAAGGTAAGTTGATGACTCATGATGAACCCTGTTCTATGGCTCCAGATGACAAACATGATCTCATATCAGGGACTTGTTCGCACCTTCCGGAGGCGTTATGAGCTGGCGGCCCTTTTTGTATCTGATTA > NC_000913/275010‑275189 | gAAAATCTCTTTTCTGGTCTGACGGCGCTTACTGCTGAATTCACTGTCGGCGAAGGTAAGTTGATGACTCATGATGAACCCTGTTCTATGGCTCCAGATGACAAACATGATCTCATATCAGGGACTTGTTCGCACCTTCCGGAGGCGTTATGAGCTGACGGCCCTTTTTGTATCTGatta < 1:61892/180‑1 (MQ=255) | GAAAATCTCTTTTCTGGTCTGACGGCGCTTACTGCTGAATTCACTGTCGGCGAAGGTAAGTTGATGACTCATGATGAACCCTGTTCTATGGCTCCAGATGACAAACATGATCTCATATCAGGGACTTGTTCGCACCTTCCGGAGGCGTTATGAGCTGGCGGCCCTTTTTGTATCTGATTA > NC_000913/275010‑275189 |
| Alignment Legend |
|---|
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 33 ≤ ATCG/ATCG < 37 ≤ ATCG/ATCG < 38 ≤ ATCG/ATCG < 39 ≤ ATCG/ATCG |
Unaligned base: atcg Masked matching base: atcg Alignment gap: ‑ Deleted base: ‑ |
| Reads not counted as support for junction |
| read_name Not counted due to insufficient overlap past the breakpoint. |
| read_name Not counted due to not crossing MOB target site duplication. |