Mutants (Isolated)

tm985

Allele Nametm985
Sequence NameT22H2.6
CGC Namepgrn-1
Worm BaseAllele Name tm985
CGC Name pgrn-1
Sequence T22H2.6
Phenotypehomozygous viable
Mutation site13245/13246-13592/13593 (347 bp deletion)
ChromosomeI
Putative gene structurejoin(13294..13572, 13820..14236, 14686..14931, 15122..15256)
Map position9.59
Balancer
Map position of balancer
Sequence of primersIntRev:GCCTCGAAGGTAACTCACGT,IntFwd:GACCAAGTTGGCGTCAGAAA,ExtRev:GCTTGTAGGTGAAGCTGCCT,ExtFwd:ACTCGGAGAAATAGGACCAA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Salazar DA, Butler VJ, Argouarch AR, Hsu TY, Mason A, Nakamura A, McCurdy H, Cox D, Ng R, Pan G, Seeley WW, Miller BL, Kao AW.
The Progranulin Cleavage Products, Granulins, Exacerbate TDP-43 Toxicity and Increase TDP-43 Levels.
J. Neurosci. 2015 35(25) 9315-28 
[ PubMed ID = 26109656 ] [ RRC reference ]

Kao AW, Eisenhut RJ, Martens LH, Nakamura A, Huang A, Bagley JA, Zhou P, de Luis A, Neukomm LJ, Cabello J, Farese RV Jr, Kenyon C.
A neurodegenerative disease mutation that accelerates the clearance of apoptotic cells.
Proc. Natl. Acad. Sci. U.S.A. 2011 108(11) 4441-6 
[ PubMed ID = 21368173 ] [ RRC reference ]

Tauffenberger A, Chitramuthu BP, Bateman A, Bennett HP, Parker JA.
Reduction of polyglutamine toxicity by TDP-43, FUS and progranulin in Huntington's disease models.
Hum. Mol. Genet. 2013 22(4) 782-94 
[ PubMed ID = 23172908 ] [ RRC reference ]

Judy ME, Nakamura A, Huang A, Grant H, McCurdy H, Weiberth KF, Gao F, Coppola G, Kenyon C, Kao AW.
A shift to organismal stress resistance in programmed cell death mutants.
PLoS Genet. 2013 9(9) e1003714 
[ PubMed ID = 24068943 ] [ RRC reference ]