分離済み変異体

tm985

Allele Nametm985
Allele Type通常株
Sequence NameT22H2.6
Gene Namepgrn-1
Worm BaseAllele Name tm985
Gene Name pgrn-1
Sequence T22H2.6
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 13245/13246-13592/13593 (347 bp deletion)
ChromosomeI
Putative gene structurejoin(13294..13572, 13820..14236, 14686..14931, 15122..15256)
Map position9.59
Balancer
Map position of balancer
Sequence of primersIntRev:GCCTCGAAGGTAACTCACGT,IntFwd:GACCAAGTTGGCGTCAGAAA,ExtRev:GCTTGTAGGTGAAGCTGCCT,ExtFwd:ACTCGGAGAAATAGGACCAA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Eck RJ, Stair JG, Kraemer BC, Liachko NF.
Simple models to understand complex disease: 10 years of progress from Caenorhabditis elegans models of amyotrophic lateral sclerosis and frontotemporal lobar degeneration.
Front Neurosci 2023 17 1300705 
[ PubMed ID = 38239833 ] [ RRC reference ]

Doyle JJ, Parker JA.
Genetic Interactions of Progranulin Across the ALS-FTD Spectrum and Beyond.
MicroPubl Biol 2023 2023  
[ PubMed ID = 38188422 ] [ RRC reference ]

Doyle JJ, Maios C, Vrancx C, Duhaime S, Chitramuthu B, Bennett HPJ, Bateman A, Parker JA.
Chemical and genetic rescue of in vivo progranulin-deficient lysosomal and autophagic defects.
Proc Natl Acad Sci U S A 2021 118(25)  
[ PubMed ID = 34140407 ] [ RRC reference ]

Butler VJ, Gao F, Corrales CI, Cortopassi WA, Caballero B, Vohra M, Ashrafi K, Cuervo AM, Jacobson MP, Coppola G, Kao AW.
Age- and stress-associated C. elegans granulins impair lysosomal function and induce a compensatory HLH-30/TFEB transcriptional response.
PLoS Genet 2019 15(8) e1008295 
[ PubMed ID = 31398187 ] [ RRC reference ]

Kao AW, Eisenhut RJ, Martens LH, Nakamura A, Huang A, Bagley JA, Zhou P, de Luis A, Neukomm LJ, Cabello J, Farese RV Jr, Kenyon C.
A neurodegenerative disease mutation that accelerates the clearance of apoptotic cells.
Proc Natl Acad Sci U S A 2011 108(11) 4441-6 
[ PubMed ID = 21368173 ] [ RRC reference ]

Judy ME, Nakamura A, Huang A, Grant H, McCurdy H, Weiberth KF, Gao F, Coppola G, Kenyon C, Kao AW.
A shift to organismal stress resistance in programmed cell death mutants.
PLoS Genet 2013 9(9) e1003714 
[ PubMed ID = 24068943 ] [ RRC reference ]

Salazar DA, Butler VJ, Argouarch AR, Hsu TY, Mason A, Nakamura A, McCurdy H, Cox D, Ng R, Pan G, Seeley WW, Miller BL, Kao AW.
The Progranulin Cleavage Products, Granulins, Exacerbate TDP-43 Toxicity and Increase TDP-43 Levels.
J Neurosci 2015 35(25) 9315-28 
[ PubMed ID = 26109656 ] [ RRC reference ]

Tauffenberger A, Chitramuthu BP, Bateman A, Bennett HP, Parker JA.
Reduction of polyglutamine toxicity by TDP-43, FUS and progranulin in Huntington's disease models.
Hum Mol Genet 2013 22(4) 782-94 
[ PubMed ID = 23172908 ] [ RRC reference ]